What is a restriction enzyme?

A restriction enzyme (restriction endonuclease) is a protein that recognizes a specific DNA sequence and cleaves double-stranded DNA at or near that sequence. They are essential tools in molecular cloning, genetic engineering, and DNA analysis. Type II restriction enzymes are the most commonly used in the lab because they cut at predictable positions within or near their recognition sequence.

What is the difference between Type II, Type IIS, and Type IIG enzymes?

Type II enzymes recognize palindromic sequences and cut within or very near the recognition site (e.g., EcoRI cuts GAATTC between G and A). Type IIS enzymes recognize asymmetric sequences and cut at a defined distance downstream of the recognition site (e.g., BsaI recognizes GGTCTC and cuts 1 nt downstream on the sense strand). Type IIG enzymes cut on both sides of the recognition site and require S-adenosyl methionine as a cofactor.

What are isoschizomers?

Isoschizomers are restriction enzymes from different organisms that recognize the same DNA sequence. For example, SmaI and XmaI both recognize CCCGGG, but SmaI cuts to produce blunt ends while XmaI produces 5-prime overhangs. Isoschizomers can differ in methylation sensitivity, optimal temperature, and buffer requirements, making them useful alternatives when one enzyme is blocked by DNA methylation.

What is star activity?

Star activity refers to non-specific cleavage at sequences similar (but not identical) to the canonical recognition sequence. It occurs under suboptimal reaction conditions such as high glycerol concentration, low ionic strength, extended digestion time, or excess enzyme. NEB High-Fidelity (HF) enzyme versions are engineered to eliminate star activity.

How does DNA methylation affect restriction enzyme digestion?

Many restriction enzymes are sensitive to DNA methylation. E. coli dam methylase modifies GATC sequences (affecting enzymes like BclI, ClaI, MboI, XbaI), while dcm methylase modifies CCWGG sequences (affecting enzymes like EcoRII, BstNI). CpG methylation in mammalian DNA blocks enzymes like HpaII, NotI, and SmaI. When choosing an enzyme, always check methylation sensitivity if your DNA was grown in a dam+/dcm+ host.

What is a 4-cutter vs. a 6-cutter?

The terms refer to the length of the recognition sequence. A 4-cutter (like AluI, AGCT) cuts on average every 4^4 = 256 bp, producing many small fragments. A 6-cutter (like EcoRI, GAATTC) cuts every 4^6 = 4,096 bp on average. 8-cutters (like NotI, GCGGCCGC) cut every ~65,536 bp, making them rare cutters useful for generating large DNA fragments for pulsed-field gel electrophoresis (PFGE).

How do I choose enzymes for a double digest?

For a double digest, choose enzymes that (1) have compatible buffer conditions (CutSmart buffer works with most NEB enzymes), (2) have the same optimal incubation temperature, (3) do not have overlapping recognition sites in your insert or vector, and (4) produce compatible or incompatible ends as needed for directional cloning. Use our Restriction Digest Planner tool to simulate the digest.

ToolsConductScience tool

Molecular BiologyFree in-browser calculator

Restriction Enzyme Finder.

Search a curated database of over 250 restriction enzymes. Filter by name, recognition sequence, overhang type, enzyme classification, cut frequency, or isoschizomer. Sortable results with CSV export. All data is client-side.

Run calculator Request a Quote

PrivateData stays in your browser

LiveNo sign-up required

Validated2026-04-07

CitableMethods and citation included

Calculator

Results update in place

Try it out

Load example Restriction Enzyme Finder data to see the full workflow

Search & Filter

Enzyme Name

Sequence (find enzymes that cut)

Overhang Type

Enzyme Type

Cut Frequency

Methylation

Isoschizomers Of

230 of 230 enzymes

Enzyme Database

Recognition↕	Cut	Overhang↕	Type↕	Frequency↕	Star↕	Buffer↕	Temp↕
GACGTC	GACGT↑C	3′ overhang	Type II	6-cutter		CutSmart	37°C
CNNNNNNNNNNNCTGC	CNNNNNNNNNN↑NCTGC	5′ overhang	Type IIG	5-cutter		CutSmart	25°C
GGTACC	G↑GTACC	5′ overhang	Type II	6-cutter		CutSmart	37°C
GTMKAC	GT↑MKAC	5′ overhang	Type II	6-cutter		CutSmart	37°C
CCGC	C↑CGC	5′ overhang	Type II	4-cutter		CutSmart	37°C
AACGTT	AA↑CGTT	5′ overhang	Type II	6-cutter		CutSmart	37°C
CTGAAG	CTGAAG (+16 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	37°C
AGCGCT	AGC↑GCT	Blunt	Type II	6-cutter		CutSmart	37°C
CTTAAG	C↑TTAAG	5′ overhang	Type II	6-cutter		CutSmart	37°C
ACRYGT	A↑CRYGT	5′ overhang	Type II	6-cutter		CutSmart	37°C
ACCGGT	A↑CCGGT	5′ overhang	Type II	6-cutter		CutSmart	37°C
ACCGGT	A↑CCGGT	5′ overhang	Type II	6-cutter		CutSmart	37°C
GACNNNNNGTC	GACNNN↑NNGTC	3′ overhang	Type II	6-cutter		CutSmart	37°C
GAANNNNNNNTTGG	GAANNNNNNNTTGG (-21 from 3′ end)	3′ overhang	Type IIG	7-cutter		CutSmart	37°C
AGCT	AG↑CT	Blunt	Type II	4-cutter		CutSmart	37°C
GGATC	GGATC (+4 from 3′ end)	5′ overhang	Type IIS	5-cutter		CutSmart	37°C
CAGNNNCTG	CAGNNN↑CTG	3′ overhang	Type II	6-cutter		CutSmart	37°C
GGGCCC	GGGCC↑C	3′ overhang	Type II	6-cutter		CutSmart	25°C
GTGCAC	G↑TGCAC	5′ overhang	Type II	6-cutter		CutSmart	37°C
RAATTY	R↑AATTY	5′ overhang	Type II	6-cutter	Low	CutSmart	50°C
RAATTY	R↑AATTY	5′ overhang	Type II	6-cutter		CutSmart	50°C
GGCGCGCC	GG↑CGCGCC	5′ overhang	Type II	8-cutter		CutSmart	37°C
GCGATCGC	GCGAT↑CGC	3′ overhang	Type II	8-cutter		CutSmart	37°C
CYCGRG	C↑YCGRG	5′ overhang	Type II	6-cutter	Moderate	CutSmart	37°C
GGWCC	G↑GWCC	5′ overhang	Type II	5-cutter		CutSmart	37°C
CCTAGG	C↑CTAGG	5′ overhang	Type II	6-cutter		CutSmart	37°C
ACNNNNGTAPY	ACNNNNGTAPY (-21 from 3′ end)	3′ overhang	Type IIG	7-cutter		CutSmart	25°C
GGATCC	G↑GATCC	5′ overhang	Type II	6-cutter	High	CutSmart	37°C
GGATCC	G↑GATCC	5′ overhang	Type II	6-cutter		CutSmart	37°C
GGYRCC	G↑GYRCC	5′ overhang	Type II	6-cutter		NEBuffer 1.1	37°C
GRGCYC	GRGCY↑C	3′ overhang	Type II	6-cutter		NEBuffer 1.1	37°C
GAAGNNNNNNTAC	GAAGNNNNNNTAC (-20 from 3′ end)	3′ overhang	Type IIG	7-cutter		CutSmart	37°C
GAAGAC	GAAGAC (+2 from 3′ end)	5′ overhang	Type IIS	6-cutter		NEBuffer 2.1	37°C
GCAGC	GCAGC (+8 from 3′ end)	5′ overhang	Type IIS	5-cutter		NEBuffer 2.1	37°C
CCATC	CCATC (+4 from 3′ end)	5′ overhang	Type IIS	5-cutter		CutSmart	37°C
ACGGC	ACGGC (+12 from 3′ end)	5′ overhang	Type IIS	5-cutter		NEBuffer 3.1	37°C
ACGGC	ACGGC (+12 from 3′ end)	5′ overhang	Type IIS	5-cutter		NEBuffer 3.1	37°C
CGANNNNNNTGC	CGANNNNNNTGC (-24 from 3′ end)	5′ overhang	Type IIG	6-cutter		CutSmart	37°C
GTATCC	GTATCC (+6 from 3′ end)	3′ overhang	Type IIS	6-cutter		NEBuffer 3.1	37°C
TGATCA	T↑GATCA	5′ overhang	Type II	6-cutter		CutSmart	50°C
GCCNNNNNGGC	GCCNNNN↑NGGC	3′ overhang	Type II	6-cutter		NEBuffer 3.1	37°C
AGATCT	A↑GATCT	5′ overhang	Type II	6-cutter		NEBuffer 3.1	37°C
AGATCT	A↑GATCT	5′ overhang	Type II	6-cutter		CutSmart	37°C
GCTNAGC	GCT↑NAGC	5′ overhang	Type II	6-cutter		CutSmart	37°C
CACGTC	CAC↑GTC	Blunt	Type II	6-cutter		CutSmart	37°C
ACTGGG	ACTGGG (+5 from 3′ end)	3′ overhang	Type IIS	6-cutter		NEBuffer 2.1	37°C
GCTAGC	GCTAG↑C	3′ overhang	Type II	6-cutter		CutSmart	37°C
GAGNNNNNCTC	GAGNNNNNCTC (-19 from 3′ end)	3′ overhang	Type IIG	6-cutter		CutSmart	37°C
CTGGAG	CTGGAG (+16 from 3′ end)	3′ overhang	Type IIS	6-cutter		NEBuffer 3.1	37°C
CCTNAGC	CC↑TNAGC	5′ overhang	Type II	6-cutter		CutSmart	37°C
CTTGAG	CTTGAG (+16 from 3′ end)	3′ overhang	Type IIS	6-cutter		NEBuffer 3.1	37°C
GATNNNNATC	GATNN↑NNATC	Blunt	Type II	6-cutter		CutSmart	60°C
GRCGYC	GR↑CGYC	5′ overhang	Type II	6-cutter		CutSmart	37°C
GGTCTC	GGTCTC (+1 from 3′ end)	5′ overhang	Type IIS	6-cutter		CutSmart	37°C
ACNNNNNCTCC	ACNNNNNCTCC (-23 from 3′ end)	5′ overhang	Type IIG	6-cutter		CutSmart	37°C
GGATG	GGATG (+2 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	55°C
GAGGAG	GAGGAG (+10 from 3′ end)	3′ overhang	Type IIS	6-cutter		NEBuffer 2.1	37°C
CCCAGC	C↑CCAGC	5′ overhang	Type II	6-cutter		CutSmart	37°C
GTGCAG	GTGCAG (+16 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	37°C
CGRYCG	CGRY↑CG	3′ overhang	Type II	6-cutter		CutSmart	60°C
GWGCWC	GWGCW↑C	3′ overhang	Type II	6-cutter		CutSmart	60°C
CGTACG	C↑GTACG	5′ overhang	Type II	6-cutter		CutSmart	55°C
CGTACG	C↑GTACG	5′ overhang	Type II	6-cutter		CutSmart	55°C
CGTCTC	CGTCTC (+1 from 3′ end)	5′ overhang	Type IIS	6-cutter		NEBuffer 3.1	55°C
GGGAC	GGGAC (+10 from 3′ end)	5′ overhang	Type IIS	5-cutter		CutSmart	65°C
GAATGC	GAATGC (+1 from 3′ end)	3′ overhang	Type IIS	6-cutter	Low	CutSmart	65°C
CTCAG	CTCAG (+9 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	37°C
ATCGAT	AT↑CGAT	5′ overhang	Type II	6-cutter		CutSmart	37°C
TCCGGA	T↑CCGGA	5′ overhang	Type II	6-cutter		CutSmart	37°C
TCATGA	T↑CATGA	5′ overhang	Type II	6-cutter		CutSmart	37°C
ACCTGC	ACCTGC (+4 from 3′ end)	5′ overhang	Type IIS	6-cutter		NEBuffer 3.1	37°C
GCTCTTC	GCTCTTC (+1 from 3′ end)	5′ overhang	Type IIS	7-cutter		CutSmart	50°C
CCGCTC	CCG↑CTC	Blunt	Type II	6-cutter		CutSmart	37°C
GCAATG	GCAATG (+2 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	65°C
RCCGGY	R↑CCGGY	5′ overhang	Type II	6-cutter		CutSmart	37°C
TGTACA	T↑GTACA	5′ overhang	Type II	6-cutter		CutSmart	37°C
TGTACA	T↑GTACA	5′ overhang	Type II	6-cutter		CutSmart	37°C
ACTGG	ACTGG (+2 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	65°C
GCGCGC	G↑CGCGC	5′ overhang	Type II	6-cutter		CutSmart	37°C
CCNGG	↑CCNGG	5′ overhang	Type II	4-cutter		CutSmart	60°C
CACGAG	C↑ACGAG	5′ overhang	Type II	6-cutter		CutSmart	37°C
GCANNNNNTGC	GCANNNN↑NTGC	3′ overhang	Type II	6-cutter		CutSmart	60°C
TTCGAA	TT↑CGAA	5′ overhang	Type II	6-cutter		CutSmart	65°C
GGTNACC	G↑GTNACC	5′ overhang	Type II	6-cutter		CutSmart	60°C
CCWGG	CC↑WGG	5′ overhang	Type II	5-cutter		NEBuffer 2.1	60°C
CGCG	CG↑CG	Blunt	Type II	4-cutter		CutSmart	60°C
CCANNNNNNTGG	CCANNNNN↑NTGG	3′ overhang	Type II	6-cutter		CutSmart	37°C
RGATCY	R↑GATCY	5′ overhang	Type II	6-cutter		CutSmart	60°C
GTATAC	GTA↑TAC	Blunt	Type II	6-cutter		CutSmart	37°C
CCRYGG	C↑CRYGG	5′ overhang	Type II	6-cutter		CutSmart	37°C
GCGATG	GCGATG (+10 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	60°C
GCGATG	GCGATG (+10 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	60°C
GGATG	GGATG (+2 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	50°C
GCAGTG	GCAGTG (+2 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	55°C
CAGTG	CAGTG (+2 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	55°C
GCNNGC	GCN↑NGC	Blunt	Type II	4-cutter		CutSmart	37°C
ATCGAT	AT↑CGAT	5′ overhang	Type II	6-cutter		CutSmart	37°C
CAANNNNNGTGG	CAANNNNNGTGG (-24 from 3′ end)	3′ overhang	Type IIG	7-cutter		CutSmart	37°C
CATG	C↑ATG	5′ overhang	Type II	4-cutter		CutSmart	25°C
GTAC	G↑TAC	5′ overhang	Type II	4-cutter		NEBuffer 3.1	25°C
CTNAG	C↑TNAG	5′ overhang	Type II	4-cutter		CutSmart	37°C
GATC	GA↑TC	Blunt	Type II	4-cutter		CutSmart	37°C
GATC	↑GATC	5′ overhang	Type II	4-cutter		DpnII	37°C
TTTAAA	TTT↑AAA	Blunt	Type II	6-cutter		CutSmart	37°C
CGGCCG	C↑GGCCG	5′ overhang	Type II	6-cutter		CutSmart	37°C
CTCTTC	CTCTTC (+1 from 3′ end)	5′ overhang	Type IIS	6-cutter		CutSmart	37°C
GGCGGA	GGCGGA (+11 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	37°C
GAGCTC	GAG↑CTC	Blunt	Type II	6-cutter		CutSmart	37°C
CTGAAG	CTGAAG (+16 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	37°C
CCTNNNNNAGG	CCTNN↑NNNAGG	5′ overhang	Type II	6-cutter		CutSmart	37°C
RGGNCCY	RG↑GNCCY	5′ overhang	Type II	6-cutter		CutSmart	37°C
GAATTC	G↑AATTC	5′ overhang	Type II	6-cutter	High	CutSmart	37°C
GAATTC	G↑AATTC	5′ overhang	Type II	6-cutter		CutSmart	37°C
GATATC	GAT↑ATC	Blunt	Type II	6-cutter	Moderate	CutSmart	37°C
GATATC	GAT↑ATC	Blunt	Type II	6-cutter		CutSmart	37°C
CATG	↑CATG	5′ overhang	Type II	4-cutter		CutSmart	55°C
CCCGC	CCCGC (+4 from 3′ end)	5′ overhang	Type IIS	5-cutter		CutSmart	55°C
GCNGC	GC↑NGC	5′ overhang	Type II	4-cutter		CutSmart	37°C
GGATG	GGATG (+9 from 3′ end)	5′ overhang	Type IIS	5-cutter		CutSmart	37°C
GGCCGGCC	GGCCGG↑CC	3′ overhang	Type II	8-cutter		CutSmart	37°C
CC	CC (+12 from 3′ end)	3′ overhang	Type IIG	4-cutter		CutSmart	37°C
TGCGCA	TGC↑GCA	Blunt	Type II	6-cutter		CutSmart	37°C
GGCC	GG↑CC	Blunt	Type II	4-cutter		NEBuffer 2.1	37°C
GACGC	GACGC (+5 from 3′ end)	5′ overhang	Type IIS	5-cutter		CutSmart	37°C
GCGC	GCG↑C	3′ overhang	Type II	4-cutter		CutSmart	37°C
GTYRAC	GTY↑RAC	Blunt	Type II	6-cutter	Moderate	CutSmart	37°C
AAGCTT	A↑AGCTT	5′ overhang	Type II	6-cutter	High	CutSmart	37°C
AAGCTT	A↑AGCTT	5′ overhang	Type II	6-cutter		CutSmart	37°C
GANTC	G↑ANTC	5′ overhang	Type II	4-cutter	Low	CutSmart	37°C
GTTAAC	GTT↑AAC	Blunt	Type II	6-cutter		CutSmart	37°C
CCGG	C↑CGG	5′ overhang	Type II	4-cutter		CutSmart	37°C
GGTGA	GGTGA (+8 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	37°C
CCTTC	CCTTC (+6 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	37°C
CCTTC	CCTTC (+6 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	37°C
ACNGT	ACN↑GT	3′ overhang	Type II	4-cutter		CutSmart	37°C
ACGT	A↑CGT	5′ overhang	Type II	4-cutter		CutSmart	37°C
TGCA	TG↑CA	Blunt	Type II	4-cutter		CutSmart	37°C
TAACTATAACGGTCCTAAGGTAGCGAA	TAACTATAACGGTC↑CTAAGGTAGCGAA	5′ overhang	Homing	8-cutter		CutSmart	37°C
TAGGGATAACAGGGTAAT	TAGGGATAA↑CAGGGTAAT	5′ overhang	Homing	8-cutter		CutSmart	37°C
GGTACC	GGTAC↑C	3′ overhang	Type II	6-cutter	Moderate	CutSmart	37°C
GGTACC	GGTAC↑C	3′ overhang	Type II	6-cutter		CutSmart	37°C
GATC	↑GATC	5′ overhang	Type II	4-cutter		CutSmart	37°C
GAAGA	GAAGA (+8 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	37°C
CAATTG	C↑AATTG	5′ overhang	Type II	6-cutter		CutSmart	37°C
CAATTG	C↑AATTG	5′ overhang	Type II	6-cutter		CutSmart	37°C
ACGCGT	A↑CGCGT	5′ overhang	Type II	6-cutter		CutSmart	37°C
GAGTC	GAGTC (+5 from 3′ end)	Blunt	Type IIS	5-cutter		CutSmart	37°C
TCCRAC	TCCRAC (+20 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	37°C
CCTC	CCTC (+7 from 3′ end)	5′ overhang	Type IIS	4-cutter		NEBuffer 2.1	37°C
TTAA	T↑TAA	5′ overhang	Type II	4-cutter		CutSmart	37°C
CCGG	C↑CGG	5′ overhang	Type II	4-cutter		CutSmart	37°C
CNNR	CNNR (+8 from 3′ end)	5′ overhang	Type IIG	4-cutter		CutSmart	37°C
GGCGCC	GG↑CGCC	5′ overhang	Type II	6-cutter		CutSmart	37°C
CCTCAGC	CC↑TCAGC	3′ overhang	Type IIS	7-cutter		CutSmart	37°C
GCAATG	GCAATG (+2 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	65°C
GCAGTG	GCAGTG (+2 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	37°C
CCATGG	C↑CATGG	5′ overhang	Type II	6-cutter	Moderate	CutSmart	37°C
CCATGG	C↑CATGG	5′ overhang	Type II	6-cutter		CutSmart	37°C
CATATG	CA↑TATG	5′ overhang	Type II	6-cutter	Moderate	CutSmart	37°C
CATATG	CA↑TATG	5′ overhang	Type II	6-cutter		CutSmart	37°C
GCTAGC	G↑CTAGC	5′ overhang	Type II	6-cutter		CutSmart	37°C
GCTAGC	G↑CTAGC	5′ overhang	Type II	6-cutter		CutSmart	37°C
CATG	CATG↑	3′ overhang	Type II	4-cutter		CutSmart	37°C
GCCGAG	GCCGAG (+21 from 3′ end)	3′ overhang	Type IIS	6-cutter		CutSmart	37°C
GCGGCCGC	GC↑GGCCGC	5′ overhang	Type II	8-cutter		CutSmart	37°C
GCGGCCGC	GC↑GGCCGC	5′ overhang	Type II	8-cutter		CutSmart	37°C
TCGCGA	TCG↑CGA	Blunt	Type II	6-cutter		CutSmart	37°C
ATGCAT	ATGCA↑T	3′ overhang	Type II	6-cutter		CutSmart	37°C
RCATGY	RCATG↑Y	3′ overhang	Type II	6-cutter		CutSmart	37°C
GGATC	GGATC (+4 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	37°C
CCTCAGC	CCTCAGC (-8 from 3′ end)	5′ overhang	Type IIS	7-cutter		CutSmart	37°C
GTCTC	GTCTC (+1 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	37°C
GCTCTTC	GCTCTTC (+1 from 3′ end)	3′ overhang	Type IIS	7-cutter		CutSmart	50°C
GAGTC	GAGTC (+4 from 3′ end)	3′ overhang	Type IIS	5-cutter		CutSmart	55°C
CCD	↑CCD	3′ overhang	Type IIS	4-cutter		NEBuffer 2.1	37°C
TTAATTAA	TTAAT↑TAA	3′ overhang	Type II	8-cutter		CutSmart	37°C
CTCGAG	C↑TCGAG	5′ overhang	Type II	6-cutter		CutSmart	37°C
ACATGT	A↑CATGT	5′ overhang	Type II	6-cutter		CutSmart	37°C
CCANNNNNTGG	CCANNNN↑NTGG	3′ overhang	Type II	6-cutter		CutSmart	37°C
TGGCAAACAGCTATTATGGGTATTATGGGT	TGGCAAACAGCTA↑TTATGGGTATTATGGGT	5′ overhang	Homing	8-cutter		CutSmart	65°C
ATCTATGTCGGGTGCGGAGAAAGAGGTAAT	ATCTATGTCGGGTGC↑GGAGAAAGAGGTAAT	5′ overhang	Homing	8-cutter		CutSmart	37°C
GAGTC	GAGTC (+4 from 3′ end)	5′ overhang	Type IIS	5-cutter		CutSmart	37°C
GTTTAAAC	GTTT↑AAAC	Blunt	Type II	8-cutter		CutSmart	37°C
CACGTG	CAC↑GTG	Blunt	Type II	6-cutter		CutSmart	37°C
GGGCCC	G↑GGCCC	5′ overhang	Type II	6-cutter		CutSmart	37°C
CTGCAG	CTGCA↑G	3′ overhang	Type II	6-cutter	Moderate	CutSmart	37°C
CTGCAG	CTGCA↑G	3′ overhang	Type II	6-cutter		CutSmart	37°C
CGATCG	CGAT↑CG	3′ overhang	Type II	6-cutter		CutSmart	37°C
CAGCTG	CAG↑CTG	Blunt	Type II	6-cutter	Moderate	CutSmart	37°C
CAGCTG	CAG↑CTG	Blunt	Type II	6-cutter		CutSmart	37°C
GTAC	GT↑AC	Blunt	Type II	4-cutter		CutSmart	37°C
CGGWCCG	CG↑GWCCG	5′ overhang	Type II	7-cutter		CutSmart	37°C
GAGCTC	GAGCT↑C	3′ overhang	Type II	6-cutter	Moderate	CutSmart	37°C
GAGCTC	GAGCT↑C	3′ overhang	Type II	6-cutter		CutSmart	37°C
CCGCGG	CCGC↑GG	3′ overhang	Type II	6-cutter		CutSmart	37°C
GTCGAC	G↑TCGAC	5′ overhang	Type II	6-cutter	High	CutSmart	37°C
GTCGAC	G↑TCGAC	5′ overhang	Type II	6-cutter		CutSmart	37°C
GCTCTTC	GCTCTTC (+1 from 3′ end)	5′ overhang	Type IIS	7-cutter		CutSmart	37°C
GATC	↑GATC	5′ overhang	Type II	4-cutter		CutSmart	37°C
CCTGCAGG	CCTGCA↑GG	3′ overhang	Type II	8-cutter		CutSmart	37°C
CCTGCAGG	CCTGCA↑GG	3′ overhang	Type II	8-cutter		CutSmart	37°C
AGTACT	AGT↑ACT	Blunt	Type II	6-cutter		CutSmart	37°C
GCATC	GCATC (+5 from 3′ end)	5′ overhang	Type IIS	5-cutter		CutSmart	37°C
GGCCNNNNNGGCC	GGCCNNNN↑NGGCC	3′ overhang	Type II	8-cutter		CutSmart	50°C
GGCGCC	GGC↑GCC	Blunt	Type II	6-cutter		CutSmart	37°C
CRCCGGYG	CR↑CCGGYG	5′ overhang	Type II	8-cutter		CutSmart	37°C
CCCGGG	CCC↑GGG	Blunt	Type II	6-cutter		CutSmart	25°C
TACGTA	TAC↑GTA	Blunt	Type II	6-cutter		CutSmart	37°C
ACTAGT	A↑CTAGT	5′ overhang	Type II	6-cutter		CutSmart	37°C
ACTAGT	A↑CTAGT	5′ overhang	Type II	6-cutter		CutSmart	37°C
GCATGC	GCATG↑C	3′ overhang	Type II	6-cutter		CutSmart	37°C
GCATGC	GCATG↑C	3′ overhang	Type II	6-cutter		CutSmart	37°C
AATATT	AAT↑ATT	Blunt	Type II	6-cutter		CutSmart	37°C
AGGCCT	AGG↑CCT	Blunt	Type II	6-cutter		CutSmart	37°C
CCWWGG	C↑CWWGG	5′ overhang	Type II	6-cutter		CutSmart	37°C
ATTTAAAT	ATTT↑AAAT	Blunt	Type II	8-cutter		CutSmart	25°C
TCGA	T↑CGA	5′ overhang	Type II	4-cutter		CutSmart	65°C
WGTACW	W↑GTACW	5′ overhang	Type II	6-cutter		CutSmart	65°C
GAWTC	G↑AWTC	5′ overhang	Type II	5-cutter		CutSmart	65°C
GCWGC	G↑CWGC	5′ overhang	Type II	5-cutter		CutSmart	65°C
CCCGGG	C↑CCGGG	5′ overhang	Type II	6-cutter		CutSmart	75°C
CASTGNN	CASTGNN (-16 from 3′ end)	3′ overhang	Type IIS	5-cutter		NEBuffer 2.1	65°C
GACNNNGTC	GACN↑NNGTC	5′ overhang	Type II	6-cutter		CutSmart	65°C
TCTAGA	T↑CTAGA	5′ overhang	Type II	6-cutter	Moderate	CutSmart	37°C
TCTAGA	T↑CTAGA	5′ overhang	Type II	6-cutter		CutSmart	37°C
CCANNNNNNNNNTGG	CCANNNNN↑NNNNTGG	3′ overhang	Type II	6-cutter		CutSmart	37°C
CTCGAG	C↑TCGAG	5′ overhang	Type II	6-cutter	High	CutSmart	37°C
CCCGGG	C↑CCGGG	5′ overhang	Type II	6-cutter		CutSmart	37°C
GAANNNNTTC	GAANN↑NNTTC	Blunt	Type II	6-cutter		CutSmart	37°C
GACGTC	GAC↑GTC	Blunt	Type II	6-cutter		CutSmart	37°C

When to use

Find restriction enzymes by name, recognition sequence, or overhang type for cloning experiments
Identify which enzymes cut a given DNA sequence and how many times
Find isoschizomers when your primary enzyme is blocked by methylation or out of stock
Filter by cut frequency to find rare cutters (8-cutters) or frequent cutters (4-cutters)
Compare enzyme properties: star activity risk, buffer compatibility, heat inactivation

Do not use for

Full digest simulation with fragment prediction — use our Restriction Digest Planner
Primer design for cloning — use our Gibson Assembly Primer Designer
Enzyme ordering — visit NEB or Thermo Fisher catalogs directly

Always check methylation sensitivity

DNA grown in standard E. coli strains (DH5α, TOP10, BL21) is dam+ and dcm+ methylated. Enzymes like BclI, ClaI, MboI, and XbaI may fail to cut dam-methylated DNA. Use isoschizomers or dam-/dcm- competent cells when needed.

Beware star activity in extended digests

Enzymes with high star activity (BamHI, EcoRI, HindIII, SalI, XhoI) can produce non-specific cutting with long incubation times, excess enzyme, or high glycerol. Use HF (High-Fidelity) versions when available to eliminate this risk.

CutSmart is not universal

While NEB CutSmart buffer works with most enzymes, some enzymes require specific buffers (e.g., DpnII buffer for DpnII, NEBuffer 2.1 for HaeIII). Always verify buffer compatibility, especially for double digests.

Check for internal sites in your insert

Before choosing cloning enzymes, check that they do not cut within your insert sequence. Use the sequence search mode to paste your full insert and verify zero internal cut sites for your chosen enzymes.

Nicking enzymes cut only one strand

Enzymes prefixed with Nb. or Nt. are nicking endonucleases that cut only one strand of double-stranded DNA. They are useful for nick translation labeling and strand displacement amplification but will not linearize plasmids.

Method

The enzyme database is curated from REBASE (Roberts et al., 2023), NEB product specifications, and published literature. Recognition sequences use standard IUPAC codes for degenerate bases. Cut positions are indexed from the 5-prime end of the recognition sequence on the sense strand. Overhang type, cut frequency, and isoschizomer grouping are computed from the recognition sequence and cut position data. Methylation sensitivity and star activity annotations are based on NEB technical documentation.

Validated

Last validated 2026-04-07. Calculations are designed for planning and documentation support; verify procurement decisions against manufacturer specifications or institutional SOPs.

How to cite

How to Cite

ConductScience Restriction Enzyme Finder (v1.26.0). ConductScience, Inc. 2026. Available at: https://conductscience.com/tools/restriction-enzyme-finder

Roberts RJ, Vincze T, Posfai J, Macelis D. REBASE—a database for DNA restriction and modification: enzymes, genes and genomes. Nucleic Acids Res. 2023;51(D1):D572-D577. doi:10.1093/nar/gkac975

Pingoud A, Wilson GG, Wende W. Type II restriction endonucleases—a historical perspective and more. Nucleic Acids Res. 2014;42(12):7489-7527. doi:10.1093/nar/gku447

New England Biolabs. REBASE: The Restriction Enzyme Database. rebase.neb.com. 2024.

Restriction enzyme classification

Restriction enzymes are classified into four main types based on their structure, recognition sequence, and cleavage mechanism:

Type I: Large, multisubunit enzymes that recognize bipartite sequences and cut at random locations far from the recognition site. Rarely used in the lab.

Type II: The workhorse enzymes of molecular biology. They recognize short (4-8 bp) palindromic sequences and cut at fixed positions within or very near the site. Over 4,000 Type II enzymes have been characterized, with ~300 commercially available.

Type IIS: A subclass of Type II that recognizes asymmetric sequences and cuts at a defined distance downstream. BsaI, BsmBI, BbsI, and SapI are used extensively in Golden Gate assembly and CRISPR guide RNA cloning.

Type III: Recognize asymmetric sequences and cut 25-27 bp downstream. Require two inversely oriented sites for cleavage. Not commonly used in cloning.

Practical considerations for restriction digests

Buffer selection: NEB CutSmart buffer is compatible with the majority of NEB restriction enzymes, simplifying double digests. Always verify compatibility for your specific enzyme pair.

Incubation temperature: Most enzymes work at 37 °C, but thermophilic enzymes (TaqI at 65 °C, BsmI at 65 °C) and psychrophilic enzymes (SmaI, ApaI, CviQI at 25 °C) require different temperatures.

Heat inactivation: Many enzymes can be inactivated at 65 °C or 80 °C for 20 minutes, eliminating the need for column purification. Check the heat inactivation temperature before relying on this.

DNA quantity: Use 1 unit of enzyme per microgram of DNA substrate for a 1-hour digest. For genomic DNA or for complete digestion, increase enzyme and incubation time (up to 10 units/μg for 4 hours).

Methylation: If digesting DNA propagated in E. coli, check whether your enzyme is dam or dcm sensitive. Use dam-/dcm- competent cells (e.g., NEB dam-/dcm- Competent E. coli, C2925) if needed.

Type IIS enzymes in modern cloning

Type IIS restriction enzymes have revolutionized DNA assembly through Golden Gate cloning:

BsaI (Eco31I): The primary Golden Gate enzyme. Recognizes GGTCTC and creates 4-nt 5-prime overhangs. Used in MoClo, GoldenBraid, and most standardized assembly systems.

BsmBI (Esp3I): Recognizes CGTCTC. Used as an alternative to BsaI when the insert contains internal BsaI sites.

BbsI (BpiI): Recognizes GAAGAC. Commonly used for CRISPR guide RNA cloning into vectors like pX330.

SapI (LguI): Recognizes GCTCTTC and creates 3-nt overhangs. Used in some gene synthesis and combinatorial assembly workflows.

The key advantage of Type IIS enzymes is scarless assembly: the enzyme recognition site is removed from the final construct, and custom 4-bp overhangs direct ordered, multi-fragment assembly in a single reaction.

Frequently asked

325

Free tools

1,200+

Institutions

100%

Client-side

Uploads required

Next steps

App