ConductScienceConductScience
ToolsConductScience tool
CRISPR / sgRNAFree in-browser calculator

sgRNA Template Oligo Designer.

Design DNA oligos for in-vitro transcription of CRISPR sgRNAs. Enter a 20-nt protospacer target, choose your Cas variant (SpCas9, SpCas9-NG, SaCas9), and get forward/reverse oligos with T7 promoter, annealing protocol, and IDT order sheet. All computation runs client-side.

Run calculator Request a Quote
PrivateData stays in your browser
LiveNo sign-up required
Validated2026-04-07
CitableMethods and citation included

Calculator

Results update in place

Try it out

Load example sgRNA Template Oligo Designer data to see the full workflow

Target Protospacer Sequence

Enter your 20-nt protospacer target (ACGT only, no PAM). Whitespace and digits are stripped automatically.

Design Settings

PAM: 5′-NGG-3′ (downstream of target)

Required for T7 in-vitro transcription

When to use

  • Generate DNA oligos for T7 in-vitro transcription of sgRNAs
  • Design guides for SpCas9, SpCas9-NG, or SaCas9 CRISPR systems
  • Create IDT-compatible order sheets for rapid oligo ordering
  • Get a ready-to-use annealing protocol for sgRNA template preparation

Do not use for

  • Finding CRISPR target sites in a genome — use CRISPOR or Cas-OFFinder first, then bring the 20-nt target here
  • Designing cloning-based sgRNA expression constructs (e.g., lentiGuide vectors) — those use BsmBI golden gate cloning, not IVT
  • Base editing or prime editing guide design — those have additional sequence requirements beyond the protospacer

Always start your target with G for T7 IVT

T7 RNA polymerase strongly prefers G at the +1 position. If your target does not start with G, you can prepend one (making a 21-nt guide with a mismatch at position 1, which usually has minimal impact on activity).

Do NOT include the PAM in your target sequence

The PAM (NGG, NG, or NNGRRT) is on the target DNA, not in the guide RNA. Including it will shift your cut site and target the wrong locus.

Use RNP delivery for reduced off-targets

Delivering sgRNA + Cas9 protein as a ribonucleoprotein (RNP) complex gives a pulse of editing activity that clears within 24–48 hours, reducing off-target effects compared to plasmid delivery.

Verify specificity with an off-target analysis tool

This tool designs the oligos but does not check off-target sites. Always run your 20-nt target through CRISPOR, Cas-OFFinder, or a similar tool to ensure specificity before committing to an experiment.

SaCas9 is ideal for AAV delivery

SaCas9 is ~1 kb smaller than SpCas9 and fits within AAV packaging limits (~4.7 kb) when paired with a compact promoter. Choose SaCas9 if your delivery method is AAV.

1

Method

Oligo design follows NEB EnGen sgRNA Synthesis Kit specifications. The forward oligo consists of: (1) T7 promoter minimal sequence (TTCTAATACGACTCACTATA), (2) the 20-nt protospacer, and (3) a scaffold overlap region specific to the Cas variant. The reverse oligo is the universal scaffold complement. Warnings are generated for targets not starting with G (T7 preference), extreme GC content (<30% or >80%), and homopolymer runs (4+ identical bases).

2

Validated

Last validated 2026-04-07. Calculations are designed for planning and documentation support; verify procurement decisions against manufacturer specifications or institutional SOPs.

3

How to cite

How to Cite

ConductScience sgRNA Template Oligo Designer (v1.22.0). ConductScience, Inc. 2026. Available at: https://conductscience.com/tools/sgrna-template-oligo-designer

Jinek M et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337:816–821. doi:10.1126/science.1225829

Ran FA et al. Genome engineering using the CRISPR-Cas9 system. Nature Protocols. 2013;8:2281–2308. doi:10.1038/nprot.2013.143

Nishimasu H et al. Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science. 2018;361:1259–1262. doi:10.1126/science.aas9129

How CRISPR-Cas9 genome editing works

CRISPR-Cas9 is a genome editing system derived from bacterial adaptive immunity. The system has two components:

1. Guide RNA (sgRNA): A ~100-nt RNA that contains a 20-nt protospacer complementary to the target DNA, fused to a scaffold sequence that binds the Cas9 protein.
2. Cas9 protein: An endonuclease that creates a double-strand break (DSB) at the target site. Cas9 requires a PAM (protospacer adjacent motif) immediately downstream of the target for recognition.

After Cas9 creates a DSB, cellular repair pathways (NHEJ or HDR) introduce insertions, deletions, or precise edits at the target locus.

In-vitro transcription workflow for sgRNA

To produce sgRNA by in-vitro transcription (IVT):

1. Design oligos: This tool generates the forward (T7 + protospacer + scaffold overlap) and reverse (scaffold complement) oligos 2. Anneal oligos: Heat to 95 °C, slow-cool to 25 °C to form a partially dsDNA template 3. IVT reaction: T7 RNA polymerase transcribes from the dsDNA promoter region, using the single-stranded scaffold overhang as a template 4. Purify: Column or phenol-chloroform purify the sgRNA, DNase-treat to remove template 5. Deliver: Electroporate or transfect sgRNA + Cas9 protein (RNP complex) into cells

Choosing a good target site

Tips for selecting an effective CRISPR target:

  • GC content: Aim for 40–70% GC. Very low or high GC reduces sgRNA activity
  • Avoid homopolymers: Runs of 4+ identical bases (especially TTTT, which acts as a Pol III terminator) can reduce expression
  • Start with G: If using T7 IVT, a leading G improves transcription efficiency
  • Check off-targets: Use Cas-OFFinder or CRISPOR to verify specificity before ordering oligos
  • Position in gene: For knockouts, target early exons (but not exon 1, which may have alternative start sites)
  • Avoid SNPs: Common variants in the target or PAM reduce cutting efficiency in some genotypes

Frequently asked

325
Free tools
1,200+
Institutions
100%
Client-side
0
Uploads required

Next steps

App

PCR Fidelity Estimator

Estimate mutation rates for genotyping PCR after CRISPR editing

Open app App

DNA / RNA Bio Converter

Convert between mass, moles, and copies for sgRNA quantification

Open app App

Gibson Assembly Reaction Calculator

Calculate Gibson assembly reactions for constructing donor templates

Open app Equipment

Electroporation Systems

Deliver sgRNA-Cas9 RNP complexes into cells by electroporation

Browse