zenodoopen
FIGURE 6 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 6. Sequence alignment of PCG and tRNA regions from 27 different Lepidoptera species. 6A, The color sequence part is motif AAGATAGAAACCAACCTGGCTYACACCGGTTTGAACTCAGATCATGTAAG; 6B, The color sequence part is motif GAAGAATGAACTAAAGCAGAAACWGGAGTWGGAGCWGCTATAGCWGCWGG; 6C, The color sequence part is motif AAYCCWGAAACTAATTCTCTTTCHCCTTCAGCAAAATCAAAAGGAGTWCG.
ShareScore
32/100
Overall dataset sharing score
Score breakdown
These five areas show where the dataset supports — or may limit — practical reuse.
- Stewardship
- 8
- Harmonization
- 4
- Access
- 12
- Reuse readiness
- 8
- Engagement
- 0