Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
4,481
datasets available to search
ShareScore release 0.9.0
Dataset results
4,481 results for “research journal”
Figure 4 from: Ridenbaugh RD, Barbeau E, Sharanowski BJ (2018) Description of four new species of Eadya (Hymenoptera, Braconidae), parasitoids of the Eucalyptus Tortoise Beetle (Paropsis charybdis) and other Eucalyptus defoliating leaf beetles. Journal of Hymenoptera Research 64: 141-175. https://doi.org/10.3897/jhr.64.24282
Figure 4 Eadya daenerys Ridenbaugh, sp. n. A Lateral habitus, holotype B Dorsal habitus, holotype C Fore and hindwing, paratype. All scale bars are 1mm in length.
Figure 5 from: Ridenbaugh RD, Barbeau E, Sharanowski BJ (2018) Description of four new species of Eadya (Hymenoptera, Braconidae), parasitoids of the Eucalyptus Tortoise Beetle (Paropsis charybdis) and other Eucalyptus defoliating leaf beetles. Journal of Hymenoptera Research 64: 141-175. https://doi.org/10.3897/jhr.64.24282
Figure 5 Eadya daenerys Ridenbaugh, sp. n. paratype. A Head, frontal view B Head, dorsal view, arrow indicating simple occipital carinae C Head and mesoscutum, dorsal view, paratype D Mesopleuron, lateral view, paratype E Propodeum, dorsal view F Propodeum, posterio-dorsal view. All scale bars are 1mm in length.
Figure 5 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 5 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Lysiphlebus samples. Tested combinations of primers were: 1) LCO1490/Lys1Rd; 2) Aph2Fd/Lys2Rd; 3) Pr2Fd/Lys2Rd; and 4) Lys3Fd/HCO2198. The species included in trials were: LF1 - L. hirticornis; LF2 - L. cardui; and LF3 - L. fabarum; M – marker.
Figure 4 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 4 Agarose gel visualizing the products of nested trials with products of direct PCR for samples PD12 - P. barbatum, PD14 - P. yomenae, and PD15 - P. yomenae. The products from PCR with Pr2Fd/Pr2Rd were submitted to secondary nested trials with primer pairs Pr2Fd/Pr2Rn and Aph2Fn/Pr2Rd. Amplicons obtained with Pr3Fd/HCO2198 were used as the template for nested reactions with Pr3Fd/Pr3Rn and Pr3Fn/HCO2198.
Figure 23 from: Boevé J, Domínguez D, Smith D (2018) Sawflies from northern Ecuador and a checklist for the country (Hymenoptera: Argidae, Orussidae, Pergidae, Tenthredinidae, Xiphydriidae). Journal of Hymenoptera Research 64: 1-24. https://doi.org/10.3897/jhr.64.24408
Figure 23 Pictures related to the single larva (P4228) found during a 3-week field trip. a Host plant with feeding damage on one of the leaves b, c Underside of that leaf occupied with the larva (arrow) d Cocoon partly damaged, showing the prepupa.
Figure 2 from: Fagan-Jeffries EP, Cooper SJB, Austin AD (2018) Three new species of Dolichogenidea Viereck (Hymenoptera, Braconidae, Microgastrinae) from Australia with exceptionally long ovipositors. Journal of Hymenoptera Research 64: 177-190. https://doi.org/10.3897/jhr.64.25219
Figure 2 Dolichogenidea finchi (holotype): a metasoma b lateral habitus c dorsal habitus d mesosoma e head.
Figure 1 from: Fernandez-Triana J, Boudreault C (2018) Seventeen new genera of microgastrine parasitoid wasps (Hymenoptera: Braconidae) from tropical areas of the world. Journal of Hymenoptera Research 64: 25-140. https://doi.org/10.3897/jhr.64.25453
Figure 1 Agupta danyi female holotype. A Habitus B Head frontal C Fore wing D Metasoma dorsal E Head and mesosoma, dorsal F Ovipositor and ovipositor sheaths.
Figure 1 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 1 Position of internal degenerative primers within the barcoding region of COI. Aphidius - specific primers: Aph1Fn, Aph1Rn, Aph1Rd, Aph2Fd, Aph2Fn, Aph2Rn, Aph2Rd, Aph3Fd, Aph3Fn and Aph3Rn; Lysiphlebus - specific primers: Lys1Fn, Lys1Rd, Lys2Fn, Lys2Rn, Lys2Rd, Lys3Fd and Lys3Fn; Praon - specific primers: Pr1Fn, Pr1Rn, Pr1Rd, Pr2Fd, Pr2Rn, Pr2Rd, Pr3Fd, Pr3Fn and Pr3Rn. Arrows refer to the direction of the primers, forward or reverse. The exact position of internal primers is designated in comparison to the first nucleotide of the forward LCO1490 primer sequence (5' GGTCAACAAATCATAAAGATATTGG 3').
Figure 4 from: Fagan-Jeffries EP, Cooper SJB, Austin AD (2018) Three new species of Dolichogenidea Viereck (Hymenoptera, Braconidae, Microgastrinae) from Australia with exceptionally long ovipositors. Journal of Hymenoptera Research 64: 177-190. https://doi.org/10.3897/jhr.64.25219
Figure 4 Dolichogenidea xenomorph: a head (paratype) b lateral habitus (paratype) c anteromesoscutum, mesoscutellum and metanotum (holotype) d propodeum and tergites (holotype) e dorsal habitus (holotype).
Figure 7 from: Boevé J, Domínguez D, Smith D (2018) Sawflies from northern Ecuador and a checklist for the country (Hymenoptera: Argidae, Orussidae, Pergidae, Tenthredinidae, Xiphydriidae). Journal of Hymenoptera Research 64: 1-24. https://doi.org/10.3897/jhr.64.24408
Figure 7 Scobina strophosa. a, b Female (P4238.A), body length 7.5 mm c, d male (P4241.B), body length 7.5 mm. a, c Dorsal views b, d ventral views.
Figure 10 from: Fernandez-Triana J, Boudreault C (2018) Seventeen new genera of microgastrine parasitoid wasps (Hymenoptera: Braconidae) from tropical areas of the world. Journal of Hymenoptera Research 64: 25-140. https://doi.org/10.3897/jhr.64.25453
Figure 10 Austinicotesia papuanus female holotype. A Habitus B Head frontal C Fore wing and hind wing D Propodeum and metasoma, dorsal E Head and mesosoma , dorsal.
Figure 12 from: Fernandez-Triana J, Boudreault C (2018) Seventeen new genera of microgastrine parasitoid wasps (Hymenoptera: Braconidae) from tropical areas of the world. Journal of Hymenoptera Research 64: 25-140. https://doi.org/10.3897/jhr.64.25453
Figure 12 Carlmuesebeckius smithsonian female holotype. A Habitus B Head frontal C Fore wing D Mesosoma dorsal E Metasoma, ovipositor and ovipositor sheaths, dorsal.
Figure 2 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 2 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Aphidius samples. Three direct PCR reactions were conducted with the following primer pairs: 1 LCO1490/Aph1Rd 2 Aph2Fd/Aph2Rd; and 3 Aph3Fd/HCO2198. The species included in trials were: AF1- A. tanacetarius, AF2- A. sussi, AF3- A. sonchi, AF4- A. linosiphonis and AF5- A. ribis. M – marker.
Figure 8 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 8 The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model. The tree with the highest log likelihood is shown. There were a total of 568 positions in the final dataset. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The percentage of replicate trees >50% in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches.
Figure 1 from: Fagan-Jeffries EP, Cooper SJB, Austin AD (2018) Three new species of Dolichogenidea Viereck (Hymenoptera, Braconidae, Microgastrinae) from Australia with exceptionally long ovipositors. Journal of Hymenoptera Research 64: 177-190. https://doi.org/10.3897/jhr.64.25219
Figure 1 Known distributions of D. xenomorph (blue circles) D. finchi (red squares) and D. mediocaudata (yellow star).
Figure 2 from: Ridenbaugh RD, Barbeau E, Sharanowski BJ (2018) Description of four new species of Eadya (Hymenoptera, Braconidae), parasitoids of the Eucalyptus Tortoise Beetle (Paropsis charybdis) and other Eucalyptus defoliating leaf beetles. Journal of Hymenoptera Research 64: 141-175. https://doi.org/10.3897/jhr.64.24282
Figure 2 Eadya annleckieae Ridenbaugh, sp. n. holotype. A Lateral habitus B Dorsal habitus C Fore and hindwing. All scale bars are 1 mm in length.
Figure 3 from: Ridenbaugh RD, Barbeau E, Sharanowski BJ (2018) Description of four new species of Eadya (Hymenoptera, Braconidae), parasitoids of the Eucalyptus Tortoise Beetle (Paropsis charybdis) and other Eucalyptus defoliating leaf beetles. Journal of Hymenoptera Research 64: 141-175. https://doi.org/10.3897/jhr.64.24282
Figure 3 Eadya annleckieae Ridenbaugh, sp. n. holotype. A Head, frontal view B Head, dorsal view C Head and mesoscutum, dorsal view D Mesopleuron, lateral view E Propodeum, dorsal view. All scale bars are 1 mm in length.
Figure 16 from: Ridenbaugh RD, Barbeau E, Sharanowski BJ (2018) Description of four new species of Eadya (Hymenoptera, Braconidae), parasitoids of the Eucalyptus Tortoise Beetle (Paropsis charybdis) and other Eucalyptus defoliating leaf beetles. Journal of Hymenoptera Research 64: 141-175. https://doi.org/10.3897/jhr.64.24282
Figure 16 Characters used in the morphometric analysis. A Frontal view of the head illustrating the morphometric character malar space (mlr.l), Eadya annleckieae Ridenbaugh, sp. n. paratype B Dorsal view of the head illustrating the morphometric characters lateral ocellar line (LOL), ocular ocellar line (OOL), posterior ocellar line (POL), and occipital ocellar line (oci.l), Eadya annleckieae Ridenbaugh, sp. n. paratype. All scale bars are 1mm in length.
Figure 15 from: Ridenbaugh RD, Barbeau E, Sharanowski BJ (2018) Description of four new species of Eadya (Hymenoptera, Braconidae), parasitoids of the Eucalyptus Tortoise Beetle (Paropsis charybdis) and other Eucalyptus defoliating leaf beetles. Journal of Hymenoptera Research 64: 141-175. https://doi.org/10.3897/jhr.64.24282
Figure 15 Cytochrome c oxidase subunit 1 amino acid sequences from Peixoto et al. (2018). Boxes indicate diagnostic molecular characters. For each sequence a unique corresponding DNA voucher code is listed as BJS followed by a number.
Figure 14 from: Ridenbaugh RD, Barbeau E, Sharanowski BJ (2018) Description of four new species of Eadya (Hymenoptera, Braconidae), parasitoids of the Eucalyptus Tortoise Beetle (Paropsis charybdis) and other Eucalyptus defoliating leaf beetles. Journal of Hymenoptera Research 64: 141-175. https://doi.org/10.3897/jhr.64.24282
Figure 14 Eadya spitzer Ridenbaugh, sp. n. paratype. A Head, frontal view B Head, dorsal view C Head and mesoscutum, dorsal view D Mesopleuron, lateral view E Propodeum, dorsal view.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.