Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
3,409
datasets available to search
ShareScore release 0.7.1
Dataset results
3,409 results for “UK”
FIGURE 7 in Reassessment of 'Plesiosaurus' megacephalus (Sauropterygia: Plesiosauria) from the Triassic-Jurassic boundary, UK
FIGURE 7. Plaster cast (BGS GSM 118410) of the ventral surface of the right forelimb of the holotype of Atychodracon megacephalus (Stutchbury, 1846) (BRSMG Cb 2335). 1, three dimensional scan with texture (colour) removed, 2, photograph, 3, interpretation. Abbreviations: 1 – distal carpal 1; 2-3 – fused distal carpals 2 and 3; 4 – distal carpal 4; h – humerus; i – metacarpal i; ii – metacarpal ii; iii – metacarpal iii; iv – metacarpal iv; v – metacarpal v; in – intermedium; r – radius; radiale; ra – radiale; u – ulna; ul – ulnare. Scale bar equals 100 mm.
FIGURE 5 in Reassessment of 'Plesiosaurus' megacephalus (Sauropterygia: Plesiosauria) from the Triassic-Jurassic boundary, UK
FIGURE 5. Posterior part of a plaster cast (BGS GSM 118410) of the holotype (BRSMG Cb 2335) skull of Atychodracon megacephalus (Stutchbury, 1846) in ventral (palatal) view. 1, three dimensional scan with texture (colour) removed, 2, photograph, 3, interpretation. Abbreviations: ang – angular; ar – articular; at – atlas; ax – axis; bs/bo? – basisphenoid or basioccipital; c3 – cervical vertebra 3; c8 – cervical vertebra 8; cr – cervical ribs; ec? – probable ectopterygoid; hy – hyoid; imf – internal mandibular foramen; mb – medial boss of retroarticular process; piv – posterior interpterygoid vacuity; ppt – posterior process of pterygoid; pro – possible additional process between zygapophyses; ps – parasphenoid; pt – pterygoid;? – unknown element. Cross-hatching represents original broken surfaces, stippling represents original matrix. Scale bar equals 100 mm.
FIGURE 4 in Reassessment of 'Plesiosaurus' megacephalus (Sauropterygia: Plesiosauria) from the Triassic-Jurassic boundary, UK
FIGURE 4. Plaster cast (BGS GSM 118410) of the anterior portion of the holotype (BRSMG Cb 2335) skull of Atychodracon megacephalus (Stutchbury, 1846). 1–3, right lateral view, 4–6, left lateral view, 7–9, oblique posterolateral view. 1, 4, 7, three dimensional scans with texture (colour) removed, 2, 5, 8, photographs, 3, 6, 9, interpretations. Abbreviations: aiv – anterior interpterygoid vacuity; ch - chin; cor – coronoid; den – dentary; en – external naris; in – internal naris; mx – maxilla; pal – palatine; pmx – premaxilla; pt – pterygoid; sp – splenial; t – teeth; vom – vomer. Cross-hatching represents original broken surfaces, stippling represents original matrix. Scale bar equals 100 mm.
FIGURE 2 in Reassessment of 'Plesiosaurus' megacephalus (Sauropterygia: Plesiosauria) from the Triassic-Jurassic boundary, UK
FIGURE 2. Plaster cast (BGS GSM 118410) of the holotype (BRSMG Cb 2335) skull of Atychodracon megacephalus (Stutchbury, 1846) in ventral (palatal) view. Three dimensional scan with texture (colour) removed. Scale bar equals 100 mm.
FIGURE 1 in Reassessment of 'Plesiosaurus' megacephalus (Sauropterygia: Plesiosauria) from the Triassic-Jurassic boundary, UK
FIGURE 1. Historical photograph of the holotype skeleton (BRSMG Cb 2335) of Atychodracon megacephalus (Stutchbury, 1846). Photograph taken from glass plate negative in the Bristol City Museum & Art Gallery, originally published by Swinton (1948). Bristol City Museum & Art Gallery, reproduced with permission. Length of skeleton equals 4960 mm.
CoMix social contact data (UK)
<p>CoMix dataset for the UK.<br><br>Additional Fundings:</p> <p>Medical Research Council (MC_PC_19065), National Institute of Health Research (CV220-088 - COMIX and NIHR200908).<br><br>Change log for V3: data up to March 2022.<br><br>Change log for V4: added information on testing status and self-reported symptoms of participants.</p>
The raw data for the research "Comparing Neural Network Models Based on Macro Perspective Economic and Environmental Indicators with ARIMA Model in predicting Construction Cost Index in UK"
<p>The raw data for the research "Comparing Neural Network Models Based on Macro Perspective Economic and Environmental Indicators with ARIMA Model in predicting Construction Cost Index in UK".</p> <p>Data collector: Runda Zheng</p>
Linked collectors and determiners for: Abyssal fauna of the UK-1 polymetallic nodule exploration area, Clarion-Clipperton Zone, central Pacific Ocean: Cnidaria.
Natural history specimen data linked to collectors and determiners held within, "Abyssal fauna of the UK-1 polymetallic nodule exploration area, Clarion-Clipperton Zone, central Pacific Ocean: Cnidaria". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/44d7b5dd-7543-4b62-b816-393ce983e0db">https://bionomia.net/dataset/44d7b5dd-7543-4b62-b816-393ce983e0db</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/44d7b5dd-7543-4b62-b816-393ce983e0db">https://gbif.org/dataset/44d7b5dd-7543-4b62-b816-393ce983e0db</a>. Formatted as a Frictionless Data package.
Linked collectors and determiners for: Abyssal fauna of the UK-1 polymetallic nodule exploration claim, Clarion-Clipperton Zone, central Pacific Ocean: Echinodermata.
Natural history specimen data linked to collectors and determiners held within, "Abyssal fauna of the UK-1 polymetallic nodule exploration claim, Clarion-Clipperton Zone, central Pacific Ocean: Echinodermata". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/0751b002-8da2-436d-981f-a02ac44783bf">https://bionomia.net/dataset/0751b002-8da2-436d-981f-a02ac44783bf</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/0751b002-8da2-436d-981f-a02ac44783bf">https://gbif.org/dataset/0751b002-8da2-436d-981f-a02ac44783bf</a>. Formatted as a Frictionless Data package.
Linked collectors and determiners for: The types of Phasmida in the Natural History Museum, London, UK.
Natural history specimen data linked to collectors and determiners held within, "The types of Phasmida in the Natural History Museum, London, UK". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/06fe2b65-d145-400e-9dfa-c4dd9d844dbf">https://bionomia.net/dataset/06fe2b65-d145-400e-9dfa-c4dd9d844dbf</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/06fe2b65-d145-400e-9dfa-c4dd9d844dbf">https://gbif.org/dataset/06fe2b65-d145-400e-9dfa-c4dd9d844dbf</a>. Formatted as a Frictionless Data package.
Linked collectors and determiners for: Charipinae from UK.
Natural history specimen data linked to collectors and determiners held within, "Charipinae from UK". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/57196654-cf6d-424f-8eb7-b30cd6f4d5a8">https://bionomia.net/dataset/57196654-cf6d-424f-8eb7-b30cd6f4d5a8</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/57196654-cf6d-424f-8eb7-b30cd6f4d5a8">https://gbif.org/dataset/57196654-cf6d-424f-8eb7-b30cd6f4d5a8</a>. Formatted as a Frictionless Data package.
UK Parliamentary Constituency boundaries for the island of Ireland, 1885-1918
<p>The 1885 UK parliamentary constituencies for Ireland were re-created in 2017 as part of a conference paper delivered at the Southern Irish Loyalism in Context conference at Maynooth University. The intial map only included the territory of the Irish Free State and was created by Martin Charlton and Jack Kavanagh. The remaining six counties of Ulster were completed by Eoin McLaughlin in 2018-19, the combined result is a GIS map of all the parliamentary constituecies across the island of Ireland for the period 1885-1918. The map is available in both ESRI Shapefile format and as a GeoPackage (GPKG). The methodology for creating the constituencies is outlined in detail below.</p> <h3>Methodology </h3> <p>A map showing the outlines of the 1855 – 1918 Constituency boundaries can be found on page 401 of <em>Parliamentary Elections in Ireland, 1801-1922</em> (Dublin, 1978) by Brian Walker. This forms the basis for the creation of a set of digital boundaries which can then be used in a GIS. The general workflow involves allocating an 1885 Constituency identifier to each of the 309 Electoral Divisions present in the boundaries made available for the 2011 Census of Population data release by CSO. The ED boundaries are available in ‘shapefile’ format (a de facto standard for spatial data transfer). Once a Constituency identifier has been given to each ED, the GIS operation known as ‘dissolve’ is used to remove the boundaries between EDs in the same Constituency. To begin with Walker’s map was scanned at 1200 dots per inch in JPEG form. A scanned map cannot be linked to other spatial data without undergoing a process known as <em>georeferencing</em>. The CSO boundaries are available with spatial coordinates in the Irish National Grid system. The goal of georeferencing is to produce a <em>rectified</em> version of the map together with a <em>world file</em>. Rectification refers to the process of recomputing the pixel positions in the scanned map so that they are oriented with the ING coordinate system; the world file contains the extent in both the east-west and north-south directions of each pixel (in metres) and the coordinates of the most north-westerly pixel in the rectified image. </p> <p>Georeferencing involves the identification of Ground Control Points – these are locations on the scanned map for which the spatial coordinates in ING are known. The Georeferencing option in ArcGIS 10.4 makes this a reasonably pain free task. For this map 36 GCPs were required for a local spline transformation. The Redistribution of Seats Act 1885 provides the legal basis for the constituencies to be used for future elections in England, Wales, Scotland and Ireland. Part III of the Seventh Schedule of the Act defines the Constituencies in terms of Baronies, Parishes (and part Parishes) and Townlands for Ireland. Part III of the Sixth Schedule provides definitions for the Boroughs of Belfast and Dublin.</p> <p>The CSO boundary collection also includes a shapefile of Barony boundaries. This makes it possible code a barony in two ways: (i) allocated completely to a Division or (ii) split between two Divisions. For the first type, the code is just the division name, and for the second the code includes both (or more) division names. Allocation of these names to the data in the ED shapefile is accomplished by a spatial join operation. Recoding the areas in the split Baronies is done interactively using the GIS software’s editing option. EDs or groups of EDs can be selected on the screen, and the correct Division code updated in the attribute table. There are a handful of cases where an ED is split between divisions, so a simple ‘majority’ rule was used for the allocation. As the maps are to be used at mainly for displaying data at the national level, a misallocation is unlikely to be noticed. The final set of boundaries was created using the dissolve operation mentioned earlier. There were a dozen ED that had initially escaped being allocated a code, but these were quickly updated. Similarly, a few of the EDs in the split divisions had been overlooked; again updating was painless. This meant that the dissolve had to be run a few more times before all the errors have been corrected.</p> <p>For the Northern Ireland districts, a slightly different methodology was deployed which involved linking <a href="https://www.townlands.ie/page/download/">parishes</a> and <a href="https://www.opendatani.gov.uk/@land-property/osni-open-data-50k-boundaries-townlands">townlands</a> along side baronies, using open data sources from the OSM Townlands.ie project and OpenData NI.</p>
Identifying the Fusarium species involved in foot rot disease of beans in the UK using a combined molecular and microbiological approach
<p><strong><span>Materials and methods</span></strong></p> <p><strong><em><span>Fungal isolation</span></em></strong></p> <p><span>Isolates (113) were prepared from both soil and infected plant samples that were received from the Plant Clinic at the Processors and Growers Research Organisation (PGRO). The samples were from different regions of England, United Kingdom (</span><span>Table</span> <span>1</span><span></span><span>). </span></p> <p><a name="_Ref165642771"></a><span>Table </span><span><span><span>1</span></span></span><span>: The locations and number of isolates obtained for infected faba bean and soil samples used in the study. * = includes soil isolates</span></p> <table> <tbody> <tr> <td> <p><span>Location</span></p> </td> <td> <p><span>Number of isolates obtained</span></p> </td> <td> <p><span>Month(s)</span></p> </td> </tr> <tr> <td> <p><span>PGRO experimental plots </span></p> </td> <td> <p><span>29</span><span>* </span><span>(13 soil, 16 plant)</span></p> </td> <td> <p><span>November 2022</span></p> </td> </tr> <tr> <td> <p><span>Cambridgeshire </span></p> </td> <td> <p><span>2</span></p> </td> <td> <p><span>June 2023</span></p> </td> </tr> <tr> <td> <p><span>Oxfordshire </span></p> </td> <td> <p><span>3</span></p> </td> <td> <p><span>June-July 2023</span></p> </td> </tr> <tr> <td> <p><span>Durham</span></p> </td> <td> <p><span>3 </span></p> </td> <td> <p><span>July 2023</span></p> </td> </tr> <tr> <td> <p><span>Shropshire </span></p> </td> <td> <p><span>4</span></p> </td> <td> <p><span>July and August2023</span></p> </td> </tr> <tr> <td> <p><span>Lincolnshire </span></p> </td> <td> <p><span>5</span></p> </td> <td> <p><span>July and August 2023</span></p> </td> </tr> <tr> <td> <p><span>Northumberland</span></p> </td> <td> <p><span>5</span></p> </td> <td> <p><span>July and August 2023</span></p> </td> </tr> <tr> <td> <p><span>Staffordshire </span></p> </td> <td> <p><span>4</span></p> </td> <td> <p><span>July<span> </span>and August 2023</span></p> </td> </tr> <tr> <td> <p><span>Suffolk </span></p> </td> <td> <p><span>4</span></p> </td> <td> <p><span>July 2023</span></p> </td> </tr> <tr> <td> <p><span>Leicestershire </span></p> </td> <td> <p><span>2</span></p> </td> <td> <p><span>July 2023</span></p> </td> </tr> <tr> <td> <p><span>Essex </span></p> </td> <td> <p><span>4</span></p> </td> <td> <p><span>July 2023</span></p> </td> </tr> <tr> <td> <p><span>Norfolk </span></p> </td> <td> <p><span>34</span></p> </td> <td> <p><span>August 2023</span></p> </td> </tr> <tr> <td> <p><span>Yorkshire </span></p> </td> <td> <p><span>6</span></p> </td> <td> <p><span>September 2023</span></p> </td> </tr> <tr> <td> <p><span>Hampshire </span></p> </td> <td> <p><span>2</span></p> </td> <td> <p><span>July 2023</span></p> </td> </tr> <tr> <td> <p><span>Undisclosed PGRO locations</span></p> </td> <td> <p><span>6</span></p> </td> <td> <p><span>Undisclosed</span></p> </td> </tr> </tbody> </table> <p><span> </span></p> <p><span>Infected plant samples were disinfected by placing pieces of infected stems/root in 10 % sodium hypochlorite solution for 5 min. The samples were rinsed twice using sterilised distilled water and placed on sterilised filter paper to be dried for 10 min at room temperature inside a laminar flow hood. The dried samples were moved to potato dextrose agar medium (PDA) inside 9 cm diameter plastic Petri dishes. Petri dishes were incubated at 22<a name="_Hlk134433128"></a> °C with 12 h fluorescent photoperiod, <a name="_Hlk165887610"></a>and light intensity of 20-25 µMol.m<sup>-2</sup>.s<sup>-1</sup>.</span></p> <p><span>Once colonies had formed, clonal isolates were prepared from the colonies as follows. Approximately 1 mm<sup>2</sup> of the colony was collected using a flame-sterilised inoculation loop and was sequentially spread onto three Petri dishes containing 2 % water agar, to dilute the inoculum gradually. The Petri dishes were incubated for 24 h as described above. The third Petri dish for each isolate was examined under a stereoscope, and one separated hypha was transferred using a flame-sterilised scalpel to another Petri dish containing PDA medium, and incubated for seven days to provide a clonal isolate. The isolates were stored for future use using two methods, for routine or long-term storage. For routine storage (months), three discs of the PDA medium containing the clonal isolate were transferred to a 2 ml microcentrifuge tube containing 1 ml of sterilised distilled water, the tube sealed with parafilm and stored at -20 °C. For long-term storage (3-4 years) the clonal isolate was plated onto a Petri dish containing many pieces of 1 cm long sterilised filter paper on PDA medium, and the colony was allowed to grow for seven days to cover the filter paper. The pieces of filter paper were removed and placed inside an empty Petri dish and dried for seven days at room temperature. The filter paper pieces were then transferred to an empty 2 ml plastic microcentrifuge tube and stored at -20 °C. Koch`s postulates were confirmed for each of the isolates by re-isolation, inoculation, and identification.</span></p> <p><span> </span></p> <p><strong><em><span>Pathogenicity testing</span></em></strong></p> <p><span>Pathogenicity testing was conducted using susceptible faba bean seedlings (cv. Lynx) grown in test tubes in a mixture of perlite/vermiculite. The growth media was prepared by adding one volume of vermiculite (the capacity of a 1000 ml plastic beaker) to one volume of perlite inside an autoclave bag; this was mixed to ensure equal distribution of each component, and 1 litre of distilled water was added. The autoclave bag was closed and autoclaved for 20 min at 121 °C, and the mixture was transferred to fill 2/3 of the test tubes (150 x 24 mm, 1.2 ml wall; borosilicate glass 150 x 24 mm, rimless, Appleton Woods Ltd), which were then sealed with cotton wool and aluminium foil, prior to being autoclaved.</span></p> <p><span>Seeds were soaked in sterilized distilled water overnight and placed in 10 % sodium hypochlorite for 5 min. The seeds were washed three times with sterilised distilled water and placed on sterilised filter paper until dry. The seeds were then transferred to 9 cm petri dishes containing 1.2 % Tap Water Agar (12 g agar in 1 l of tap water, autoclaved in a 2 l conical flask), where they were allowed to germinate for four days in the incubator at 24 </span><span><span>°</span></span><span>C before being transferred to test tubes containing the vermiculite/perlite mixture. </span></p> <p><span>Following transfer, the seedlings were allowed to grow for five to seven days until they were suitable for inoculation (4-5 cm root length). The seedlings were inoculated by placing a 10 mm block of PDA medium containing a ten-day old fungal culture against the stem base. A small piece of sterilised cotton was placed around the stem to ensure adequate moisture at the inoculation site. The inoculated seedlings were incubated at 24 </span><span><span>°</span></span><span>C, with a 12 h photoperiod and light intensity of 20-25 µMol.m<sup>-2</sup>.s<sup>-1</sup>.</span></p> <p><span>Disease severity was monitored daily from 5-6 days after inoculation. Root and stem infection were scored on days 15 and 25 using a 5-point scale (</span><span>Figure <span>2</span></span><span></span><span>):</span></p> <p><span>0 = healthy roots, no discolouration.</span></p> <p><span>1 = up to 20 % root or stem base discoloured.</span></p> <p><span>2 = 20-40 % root or stem base discoloured.</span></p> <p><span>3 = 40-60 % root or stem base discoloured.</span></p> <p><span>4 = 60-80 % root or stem base discoloured, stunting of plant.</span></p> <p><span>5 = total discoloration, dead plant.</span></p> <p><strong><em><span>DNA extraction</span></em></strong></p> <p><span>Clonal colonies were cultured on 50 ml of Potato Dextrose Broth (PDB) medium (FORMEDIUM<sup>TM</sup>) in a 250 ml flask and incubated for seven days on a rotary shaker (22 °C with 70 RPM). The mycelium for each isolate was harvested by transferring the contents of each flask into a 50 ml falcon tube and centrifuging at 5000 RPM for 10 min. The supernatant was discarded, and the mycelium pellet stored at -20 °C. Mycelium (1 ml) was transferred to a 2 ml safe-lock microcentrifuge tube. The tubes were covered with parafilm which was pierced to allow moisture to evaporate. Samples were freeze-dried (-45 °C, 0.133 mbar) for 48 h. Freeze-dried mycelium (15 mg) was transferred to a 2 ml safe lock microcentrifuge tube containing two carbon steel ball bearings (3 mm diameter, grade 1000, SimplyBearings). The mycelium was homogenised for 4 min using a TissueLyser (Retsch MM400; 30 RPS), after which 120 µl of TNES buffer was added and the samples were homogenised again as before.</span></p> <p><span>Total DNA was extracted from the samples following the BOMB-Bio nucleic acid tissue DNA extraction protocol </span><span><span>(</span><span>Oberacker <em>et al.</em>, 2019</span><span>)</span></span><span>. The samples were incubated at 55 °C overnight after adding 2 µl of proteinase K and 3 µl of RNAase A. Following incubation, 240 µl of GITC lysis buffer was added, mixed and samples incubated at room temperature for 5 min. Isopropanol (480 µl) was added and, following centrifugation (5000 RPM; 5 min), 650 µl was transferred to a new tube with 200 µl of 1X BOMB-Bio magnetic bead solution (1:50 carboxylated SeraMag Speed Beads magnetic beads in TE) and mixed. The solution was placed on a magnetic rack to hold the beads with DNA bound to them in place whilst the supernatant was removed. The beads with bound DNA were washed once with isopropanol (400 µl) and twice with 80 % ethanol (400 µl). The solution was removed from the magnet, beads were allowed to dry briefly and 70 µl of nuclease free water was added to elute the DNA. The beads were removed by placing the samples back on the magnetic rack and transferring the supernatant to a new tube. The extracted DNA concentration was estimated using a Qubit 4 and 1X dsDNA High Sensitivity (HS) Assay Kit (Invitrogen) according to the manufacturer’s instructions.</span></p> <p><strong><em><span>Polymerase Chain Reaction (PCR)</span></em></strong></p> <p><span><span>DNA was amplified using PCR with three sets of primers: Internal Transcribed Spacer (ITS) primers</span></span><span> ITS1/ITS4 </span><span><span>(</span><span>Raja <em>et al.</em>, 2017</span><span>)</span></span><span> and two sets of Translation Elongation Factor one α primers, 1018F/1620R and EF1/EF2 </span><span><span>(</span><span>O’Donnell <em>et al.</em>, 1998; Raja <em>et al.</em>, 2017</span><span>)</span></span><span>. Prior to PCR, the template DNA concentration was adjusted to<a name="_Hlk133674492"></a> 5 ng/μl using molecular grade water. The PCR mix <a name="_Hlk133674557"></a>contained: 12.5 µl of 2x MyTaq Red Mix (Meridian Bioscience), 3 µl of template DNA, 1 µl of each primer (10 µM) and 7.5 µl of nuclease free water to a final volume of 25 µl. The cycling conditions and sequence of each primer are given in </span><span>Table <em><span>2</span></em></span><span>. The PCR products were separated alongside a 1 kbp ladder (GeneRuler 1 kb Plus DNA Ladder Thermo scientific SM1331) using gel electrophoresis in a 1 % agarose gel in TAE buffer stained with GelRed® nucleic acid stain (Sigma Aldrich). Gels were visualised with a UV transilluminator (BioRad) to confirm successful amplification. </span></p> <p><a name="_Ref162427061"></a><span>Table </span><span><span><span>2</span></span></span><span>: The ITS (ITS1 and ITS4) and TEF1α (1018F, 1620R, EF1 and EF2) primer sequences and PCR conditions.</span></p> <table> <tbody> <tr> <td> <p><span>Primer</span></p> </td> <td> <p><span>Sequence (5’-3’)</span></p> </td> <td> <p><span>Initial Melt</span></p> </td> <td> <p><span>Melt</span></p> </td> <td> <p><span>Anneal</span></p> </td> <td> <p><span>Extension</span></p> </td> <td> <p><span>Final extension</span></p> </td> </tr> <tr> <td> <p><span>ITS1:</span></p> <p><span>ITS4:</span></p> <p><span><span> </span></span><span><span>(Raja et al., 2017)</span></span></p> </td> <td> <p><span>CGTAGGTGAACCTGCGG</span></p> <p><span>TCCTCCGCTTATTGATATGC</span></p> </td> <td> <p><span>94 °C</span></p> <p><span>5 min</span></p> </td> <td> <p><span>94°C</span></p> <p><span>30 sec</span></p> </td> <td> <p><span>55 °C</span></p> <p><span>1 min</span></p> </td> <td> <p><span>72 °C</span></p> <p><span>2 min</span></p> </td> <td> <p><span>72 °C</span></p> <p><span>7 min</span></p> </td> </tr> <tr> <td> <p><span>35 cycles</span></p> </td> </tr> <tr> <td> <p><span>1018F:</span></p> <p><span>1620R:</span></p> <p><span>(O’Donnell et al., 1998; Raja et al., 2017)</span></p> </td> <td> <p><span>GAYTTCATCAAGAACATGAT</span></p> <p><span>GACGTTGAADCCRACRTTGTC</span></p> </td> <td> <p><span>94 °C</span></p> <p><span>5 min</span></p> <p><span> </span></p> </td> <td> <p><span>94 °C</span></p> <p><span>30 sec</span></p> </td> <td> <p><span>Touch down 66-56 °C</span></p> <p><span>1 min</span></p> <p><span> </span></p> </td> <td> <p><span>72 °C</span></p> <p><span>1 min</span></p> </td> <td> <p><span>72 °C</span></p> <p><span>10 min</span></p> </td> </tr> <tr> <td> <p><span>9 cycles </span></p> </td> </tr> <tr> <td> <p><span>94 °C</span></p> <p><span>30 sec</span></p> </td> <td> <p><span>56 °C</span></p> <p><span>1 min</span></p> <p><span> </span></p> </td> <td> <p><span>72 °C</span></p> <p><span>1 min</span></p> </td> </tr> <tr> <td> <p><span>Remaining 26 cycles</span></p> </td> </tr> <tr> <td> <p><span>EF1:</span></p> <p><span>EF2:</span></p> <p><span><span>(O’Donnell <em>et al.</em>, 1998)</span></span><span> </span><span><span>(Raja <em>et al.</em>, 2017)</span></span></p> </td> <td> <p><span>ATGGGTAAGGARGACAAGAC</span></p> <p><span>GGARGTACCAGT SATCATGTT</span></p> <p><span> </span></p> </td> <td> <p><span>95 °C</span></p> <p><span>2 min</span></p> </td> <td> <p><span>95 °C</span></p> <p><span>30 sec</span></p> </td> <td> <p><span>54.1 °C</span></p> <p><span>1 min</span></p> </td> <td> <p><span>72 °C</span></p> <p><span>1 min</span></p> </td> <td> <p><span>72 °C</span></p> <p><span>5 min</span></p> </td> </tr> <tr> <td> <p><span>35 cycles</span></p> </td> </tr> <tr> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> </tr> </tbody> </table> <p><span> </span></p> <p><span>Prior to sequencing, the PCR products were purified using solid-phase reversible immobilisation (SPRI) magnetic beads. To each PCR product, 1 X SPRI beads were added at a 1:2 ratio of PCR product to bead solution (50 µl PCR product to 100 µl SPRI beads) and the mixture incubated for 5 min at room temperature. The tubes were transferred to the magnetic plate for 5 min until the solution was clear, at which point the supernatant was discarded and the beads were washed twice with 80% ethanol for 60 s each time. Ethanol was removed and the beads held on the magnetic plate were allowed to dry for 5-10 min at room temperature. The tubes containing the dry beads were removed from the magnetic plate, and 50 µl of molecular grade nuclease free water was added to each tube, mixed and incubated for 5 min, allowing the DNA to elute. The tubes were placed back on the magnetic plate for 5 min until the solution was clear, at which point the supernatant was transferred to a new 1.5 ml microcentrifuge tube. Sanger sequencing was carried out using ITS1, ITS4 primers and EF1, EF2 primers. All sequencing was carried out by Eurofins Genomics.</span></p> <p><span>Following sequencing, the chromatograms obtained were trimmed and analysed using Geneious Prime (version 2023.0.4). First, low-quality bases (e.g., overlapping peaks) were trimmed from each end and the sequence upstream from that site, including the primer sequence, was deleted. The forward and reverse sequence for each sample were assembled using the <em>de novo</em> assemble function in Geneious at the highest sensitivity to create a consensus sequence (highest threshold quality: 60%). A basic local alignment search tool (BLAST) search was carried out for the consensus sequences using the NCBI-NR database for the ITS sequences, and, for the TEF1α sequences, the data available on the Fusarium ID database </span><span><span>(Torres-Cruz <em>et al.</em>, 2022)</span></span><span>. All of the <em>TEF1</em>α consensus sequences from all samples were subsequently aligned with the available sequences on the Fusarium ID database (Geneious global alignment with free end gaps, 65% similarity), and a phylogenetic tree was generated (genetic distance model Tamura-Nei, neighbour joining method, bootstrap with 100 replicates).</span></p>
Terretrial LiDAR data collected from St Pancras Old Church, Camden, UK
<p>Terrestrial LiDAR data collected by the team at University College London.</p><p>This is Version 2 containing data processed into 10 m x 10 m tiles, this has also been filtered to remove high "deviation" points.</p><p>Data is in .ply format containing xyz fields as well as reflectance, deviation, range, return number and scan position<\p></p><p><b>UCL project name</b>: 2017-07-18.001.riproject</p><p><b>Plot ID</b>: STP</p><p><b>State or region</b>: Camden</p><p><b>Date project started</b>: 7/18/2017</p><p><b>Area scanned</b>: 25,392 m2</p><p><b>Instrument</b>: UCL RIEGL VZ-400</p><p><b>Scan pattern</b>: 19 positions</p><p><b>Angular resolution</b>: 0.04</p><p><b>Images captured</b>: No</p><p><b>Links to media</b>: </p><p><b>Number of scans</b>: 38</p><p><b>Google Maps URL</b>: https://www.google.com/maps/place/The+Hardy+Tree/@51.5348275,-0.1302261,19.07z/data=!4m5!3m4!1s0x48761b22ae4a50ff:0x5ee5e6d9819cb888!8m2!3d51.5351276!4d-0.1297699</p><p><b>Publications</b>: https://doi.org/10.1186/s13021-018-0098-0, https://doi.org/10.1016/j.rse.2020.112102</p><p>For more information on the methods used to capture TLS data please refer to <a href="https://doi.org/10.1016/j.rse.2017.04.030">Wilkes et al. 2017</a></p><p>Please acknowldege the producers of this data set if using this data for publication.</p>
Data and code for 'Food insecurity and patterns of dietary intake in a sample of UK adults'
<p>Data and code for ' <strong>Food insecurity and patterns of dietary intake in a sample of UK adults</strong>' by Shinwell et al.</p> <p>For the UK data, the script 'analysis UK dataset.r' is required along with the csv data file.</p> <p>For the NHANES data analyses, the user needs to:</p> <p>a) Download the required 2013-4 NHANES data files as described at https://zenodo.org/record/3361283</p> <p>b) Run the script 'merging.script.r' from https://zenodo.org/record/3361283</p> <p>c) Using the resulting .csv file in conjunction with the script 'analysis NHANES dataset.r' to reproduce the analyses in the paper.</p> <p>The reason for doing it this indirect way is that the raw NHANES data are not ours to share.</p>
Geographic boundary for OAL-UK
<p>Shapefile containing the geographic boundary for OAL-UK</p>
Nature-based Solutions at OAL-UK
<p>Shapefile containing the spatial distribution of the planned NBS interventions at OAL-UK</p>
FIG. 4 in Reassessment of the oldest British turtle: Protochelys from the Middle Jurassic Stonesfield Slate of Stonesfield, Oxfordshire, UK
FIG. 4. — Chelonian fifth vertebral and pleural scales, Stonesfield Slate (UK), middle Bathonian: A, B, fifth vertebral; C-E, pleural scales; A, OUMNH J40407, complete fifth vertebral; B, BMNH 39198a, external mould of the right side of a fifth vertebral; C, D, BMNH R247b, complete right third pleural (D is the external mould); E, BMNH 39198, external mould of an almost complete scale (E1, non oriented) which can be interpreted either as a right fourth pleural (E2, preferred hypothesis) or as a left first pleural (E3) (the specimen is an external mould and needs to be reversed to retrieve the normal orientation). Abbreviations: M, marginal scale; P, pleural scale; V, vertebral scale. Scale bars: 10 mm (Figures E2 and E3 are not to scale).
FIG. 1 in Reassessment of the oldest British turtle: Protochelys from the Middle Jurassic Stonesfield Slate of Stonesfield, Oxfordshire, UK
FIG. 1. — Specimens from the Stonesfield Slate (UK) misidentified as chelonian: A, BMNH R896, specimen identified by Lydekker (1889: 222) as a "scapulo-precoracoid", but more probably an archosaur cervical rib; B, OUMNH J29907,fish scale labelled as a turtle scale; C, OUMNH unnumbered, specimen (two slabs) labelled as a turtle bony plate which consists of a splinter of compact bone maybe from a crocodilian osteoderm. Scale bars: 10 mm.
FIG. 2 in Reassessment of the oldest British turtle: Protochelys from the Middle Jurassic Stonesfield Slate of Stonesfield, Oxfordshire, UK
FIG. 2. — Turtle bones from the Stonesfield Slate (UK), middle Bathonian: A, BMNH 37979, right coracoid in dorsal view (proximal to the right) figured in Mackie (1863); B, BMNH R5320, plastron fragment (hyo- or hypoplastron) probably from the bridge area. Scale bars: 10 mm.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.