Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
3,409
datasets available to search
ShareScore release 0.7.1
Dataset results
3,409 results for “UK”
FIG. 5 in Reassessment of the oldest British turtle: Protochelys from the Middle Jurassic Stonesfield Slate of Stonesfield, Oxfordshire, UK
FIG. 5. — Reconstruction of the Stonesfield turtle, middle Bathonian: A, reconstruction based on available specimens (note that these specimens are not from the same individuals nor at the same scale); B, proposed reconstruction of the carapace of the Stonesfield turtle. The morphology of the first and second pleural (dashed lines) can be deduced from that of neighbouring scales. Marginals are unknown at Stonesfield and therefore are not represented on the present reconstruction.
Text-fig. 6. a. Vertical section showing part of body-chamber of a Cenoceras in the top of the Main Cenoceras Bed associated with attached oysters below and stringers of crinoid debris below and stretching laterally. Coin 23 mm in diameter. b. Complete lateral half of conch showing intact and elastically deformed septa on which rests crinoid debris that spreads across the exposed septa and onto the adjacent substrate. Conch approximately 180 mm in diameter. c. Individual showing dispersed crinoid and molluscan debris within body-chamber and septa in the crushed inner whorls that have taken a sparite cement prior to, and after having undergone brittle deformation. 160 mm in diameter. d. Vertically embedded specimen showing the loss of septa in the inner whorls that are infilled with matrix mottled by bioturbation. Tape measure provides scale. in 'Cenoceras Islands' In The Blue Lias Formation (Lower Jurassic) Of West Somerset, Uk: Nautilid Dominance And Influence On Benthic Faunas
Text-fig. 6. a. Vertical section showing part of body-chamber of a Cenoceras in the top of the Main Cenoceras Bed associated with attached oysters below and stringers of crinoid debris below and stretching laterally. Coin 23 mm in diameter. b. Complete lateral half of conch showing intact and elastically deformed septa on which rests crinoid debris that spreads across the exposed septa and onto the adjacent substrate. Conch approximately 180 mm in diameter. c. Individual showing dispersed crinoid and molluscan debris within body-chamber and septa in the crushed inner whorls that have taken a sparite cement prior to, and after having undergone brittle deformation. 160 mm in diameter. d. Vertically embedded specimen showing the loss of septa in the inner whorls that are infilled with matrix mottled by bioturbation. Tape measure provides scale.
Text-fig. 2. General view of Helwell Bay, Doniford, looking west along the upper beach exposure and the Main Cenoceras Bed. in 'Cenoceras Islands' In The Blue Lias Formation (Lower Jurassic) Of West Somerset, Uk: Nautilid Dominance And Influence On Benthic Faunas
Text-fig. 2. General view of Helwell Bay, Doniford, looking west along the upper beach exposure and the Main Cenoceras Bed.
Text-fig. 4. Sedimentological log of the Main Cenoceras Bed and associated strata in the Quantocks Beds (Lyra Subzone) at Helwell Bay, Doniford (measured at NGR ST 0802 4314 and ST 0336 4305). BGS bed no. refers to bed numbers employed in Whittaker and Green (1983). in 'Cenoceras Islands' In The Blue Lias Formation (Lower Jurassic) Of West Somerset, Uk: Nautilid Dominance And Influence On Benthic Faunas
Text-fig. 4. Sedimentological log of the Main Cenoceras Bed and associated strata in the Quantocks Beds (Lyra Subzone) at Helwell Bay, Doniford (measured at NGR ST 0802 4314 and ST 0336 4305). BGS bed no. refers to bed numbers employed in Whittaker and Green (1983).
Text-fig. 1. Map of Southwest England indicating general and detailed location of the Watchet to St. Audries Bay area on the West Somerset coast. in 'Cenoceras Islands' In The Blue Lias Formation (Lower Jurassic) Of West Somerset, Uk: Nautilid Dominance And Influence On Benthic Faunas
Text-fig. 1. Map of Southwest England indicating general and detailed location of the Watchet to St. Audries Bay area on the West Somerset coast.
Text-fig. 7. a. Worn section through a horizontally bedded body-chamber and phragmocone, body-chamber showing oyster attached to inside of aperture as well as burrow mottling. Tape measure provides scale. b. Body-chamber and crushed phragmocone with body-chamber and phragmocone entirely filled with bioturbated matrix containing stringers of crinoid and molluscan debris. Flank of phragmocone encrusted by oysters. Tape measure for scale. c. Complex of Thallassinoides and Diplocraterion burrows associated with conch that has been eroded out by wave action. A few 'Ghostly' fragments of ammonite are also present. Original scope of the image approximately 400 mm. c. Verically embedded conch with largely intact septa and camera infilled with burrowed matrix containing crinoid debris. Tape measure for scale. in 'Cenoceras Islands' In The Blue Lias Formation (Lower Jurassic) Of West Somerset, Uk: Nautilid Dominance And Influence On Benthic Faunas
Text-fig. 7. a. Worn section through a horizontally bedded body-chamber and phragmocone, body-chamber showing oyster attached to inside of aperture as well as burrow mottling. Tape measure provides scale. b. Body-chamber and crushed phragmocone with body-chamber and phragmocone entirely filled with bioturbated matrix containing stringers of crinoid and molluscan debris. Flank of phragmocone encrusted by oysters. Tape measure for scale. c. Complex of Thallassinoides and Diplocraterion burrows associated with conch that has been eroded out by wave action. A few 'Ghostly' fragments of ammonite are also present. Original scope of the image approximately 400 mm. c. Verically embedded conch with largely intact septa and camera infilled with burrowed matrix containing crinoid debris. Tape measure for scale.
Text-fig. 8. a. Shell belonging to one flank of the conch a horizontally bedded individual with sveral large oysters attached to its underside indicating that the shell was either originally vertical or was flipped from one surface to the other by turbulance. Approximately 300 mm across. b. Crushed individual showing oysters encrusting both flanks of the conch. 250 mm in diameter. c. Wave-worn conch showing oysters attached to the umbilicus, the venter and possibly the inside of the body-chamber. Tape measure for scale. d. Flank of conch with crinoid debris and oysters spread around its periphery. Scope of image approximately 350 mm. in 'Cenoceras Islands' In The Blue Lias Formation (Lower Jurassic) Of West Somerset, Uk: Nautilid Dominance And Influence On Benthic Faunas
Text-fig. 8. a. Shell belonging to one flank of the conch a horizontally bedded individual with sveral large oysters attached to its underside indicating that the shell was either originally vertical or was flipped from one surface to the other by turbulance. Approximately 300 mm across. b. Crushed individual showing oysters encrusting both flanks of the conch. 250 mm in diameter. c. Wave-worn conch showing oysters attached to the umbilicus, the venter and possibly the inside of the body-chamber. Tape measure for scale. d. Flank of conch with crinoid debris and oysters spread around its periphery. Scope of image approximately 350 mm.
Text-fig. 9. a. Shorn-off, vertically embedded conch surrounded by layer of crinoid debris at level of planation of shell and with some debris within the conch at this level. Lateral width of body-chamber 80 mm. b. Example of ammonite that occurs rarely in the Main Cenoceras Bed. Note the poorly defined shell particularly on the outer whorl, suggesting partial dissolution. Tape measure for scale. in 'Cenoceras Islands' In The Blue Lias Formation (Lower Jurassic) Of West Somerset, Uk: Nautilid Dominance And Influence On Benthic Faunas
Text-fig. 9. a. Shorn-off, vertically embedded conch surrounded by layer of crinoid debris at level of planation of shell and with some debris within the conch at this level. Lateral width of body-chamber 80 mm. b. Example of ammonite that occurs rarely in the Main Cenoceras Bed. Note the poorly defined shell particularly on the outer whorl, suggesting partial dissolution. Tape measure for scale.
Clinical Trial Transparency at UK Universities (2018-2021)
<p>This dataset describes the analysis 20 U.K. universities' clinical trial registration and reporting policies and reporting performance of CTIMPs on EUCTR. This is supplementary information on a publication in the journal Clinical Trials: Journal of the Society for Clinical Trials. The manuscript is titled "Improving clinical trial transparency at U.K. universities: evaluating three years of policies and reporting performance on the European Clinical Trial Registry (EUCTR)". Please refer to the manuscript for more information on the methodology and analysis.</p>
Plant Communities at the Eden Project, UK, derived from soil eDNA
<p>The project seeks to understand the potential for the use of eDNA collected from soil to characterise plant communities. To do so, soils were sampled at the Eden Project in Cornwall UK, within the two covered biomes where we have a good understanding of the structure and composition of plant communities (further quantified with above ground plant coverage inventories). 32 plots were established across 10 different plant assemblages, each of which experiences subtle differences in soil chemistry and microclimate. Each plot consists of a 2 x 2 m quadrat, with four soil aggregates collected at each corner. </p> <p>eDNA was then extracted and amplified following the methods detailed in Zinger et al. (2016) and Donald et al. (2021). The primers used targeted the P6 loop of thechloroplastic trnL intron [primer_fwd: GGGCAATCCTGAGCCAA, primer_rev: CCATTGAGTCTCTGCACCTATC] (Taberlet et al. 2007). 16 Extraction, 54 Sequencing, and 16 PCR controls are included so as to account for potential errors generated during the processing of samples, with a mock community (4 positive controls) of 10 known plant sequences also included to guide filtering thresholds. PCR products were pooled and sequencing libraries were constructed using the Illumina TruSeq NanoPCRFree kit following the supplier’s instructions (Illumina Inc., San Diego, California, USA), except that the ligation product was not PCR amplified to limit tag-jump biases (Taberlet et al 2018). The libraries were then sequenced on an Illumina Hiseq platform (San Diego, CA, USA).</p> <p>Sequencing was conducted by the GenoToul bioinformatics platform (Toulouse, France), with the OBITOOLS package (Boyer et al. 2016). Here, the produced sequence data was processed using the following steps. First, ‘illuminapairedend’ was used to assemble paired-end reads. This algorithm is based on an exact alignment algorithm that considers the quality scores at all positions during the assembly process. Subsequently, we used the ‘ngsfilter’ command to identify and remove the primers and tags on each read, and assign reads to their respective samples (NGS filter file provided: <strong>ngsfilter_TRNL_PLANTS_EDEN_PROJECTb.txt</strong>). This program was used with its default parameters tolerating two mismatches for each of the two primers and no mismatch for the tags. Following this, sequencing reads were dereplicated using the ‘obiuniq’ command. The produced <strong>data.uniq.fasta</strong> file is supplied here. Sequences were then further filtered to remove sequences of low quality (containing Ns or with paired-end alignment scores below 50), and sequences represented by only one read (singletons) using the ‘obigrep’ command. To remove PCR/sequencing errors as well as intraspecific variability, we built OTUs (Operational Taxonomic Units) using the ‘sumaclust’ clustering algorithm (Mercier et al. 2013), which considers the most abundant sequence of each cluster as the cluster representative. OTUs were set at a sequence similarity threshold of 95%. To assign a taxon to plant OTUs, we built a reference sequence database using the ecoPCR programme (Ficetola et al. 2010) on the European Molecular Biology Laboratory (EMBL; release 141). OTUs were then assigned a taxonomy, using OBITOOL’s ecotag programme (Boyer et al. 2016), which performs a global alignment of each OTU sequence (the query) against each reference. The reference taxon assigned to each OTU corresponds to the Last Common Ancestor of all the best-match sequences for the query. </p> <p><br> Datasets were subsequently filtered to remove contaminants as well as artefacts such as PCR chimeras and remaining sequencing errors, using routines implemented in the metabaR R package (Zinger et al 2021), in R version 3.6.1 (R Development Core Team, 2013). The filtering process consisted of four steps: (i) a negative control-based filtering. OTUs whose maximum abundance was found in extraction/PCR negative controls were removed from the dataset, as they were likely to be reagent/aerosol contaminants, better amplified in the absence of competing DNA fragments as it is the case in biological samples. (ii) a reference-based filtering. OTUs which are too dissimilar from sequences available in reference databases are potential chimeras generated during sequencing and amplification. In this study, we chose to set similarity thresholds at 100%. (iii) an abundance-based filtering. This procedure targets incorrect assignment of a few numbers of sequences corresponding to true OTUs occurring to the wrong sample, a phenomenon called “tag-switching”. It consists in setting OTUs abundances to 0 in samples where their abundance represents < 0.03% of the total OTU abundance in the entire dataset. (iv) Finally, we conducted a PCR-based filtering by considering any PCR reaction that yielded less than 1000 reads as non-functional, and removed them from the dataset. The script used for implementing this is provided (<strong>metabaR_Eden_Plants_100sim.html)</strong>, with sequence data processed to remove contaminants, OTUs of low taxonomic resolution, and PCRs with too low a read count. The clean data is provided (<strong>eden_plant_postclean_100sim.rds</strong>).</p> <p>References:</p> <p>Boyer, F. <em>et al.</em> (2016) ‘obitools: a unix-inspired software package for DNA metabarcoding’, <em>Molecular Ecology Resources</em>, 16(1), pp. 176–182. doi:<a href="https://doi.org/10.1111/1755-0998.12428">10.1111/1755-0998.12428</a>.</p> <p>Donald, J. <em>et al. (2021) '</em>‘Multi-taxa environmental DNA inventories reveal distinct taxonomic and functional diversity in urban tropical forest fragments.‘ <em>Global Ecology and Conservation</em> 29 (2021): e01724.</p> <p>Mercier, C. <em>et al.</em> (2013) ‘SUMATRA and SUMACLUST: fast and exact comparison and clustering of sequences’, in <em>Programs and Abstracts of the SeqBio 2013 workshop. Abstract</em>. Citeseer, pp. 27–29.</p> <p>Taberlet, P. <em>et al.</em> (2007) ‘Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding’, <em>Nucleic Acids Research</em>, 35(3), pp. e14–e14. doi:<a href="https://doi.org/10.1093/nar/gkl938">10.1093/nar/gkl938</a>.</p> <p>Taberlet, P. <em>et al.</em> (2018) <em>Environmental DNA: For Biodiversity Research and Monitoring</em>. Oxford University Press.</p> <p>Team, R.C. (2013) <em>R: A language and environment for statistical computing</em>. Vienna, Austria.</p> <p>Zinger, L. <em>et al.</em> (2016) ‘Extracellular DNA extraction is a fast, cheap and reliable alternative for multi-taxa surveys based on soil DNA’, <em>Soil Biology and Biochemistry</em>, 96, pp. 16–19.</p> <p>Zinger, L. et al. (2021) ‘metabaR: An r package for the evaluation and improvement of DNA metabarcoding data quality’, Methods in Ecology and Evolution. DOI: <a href="https://doi.org/10.1111/2041-210X.13552">https://doi.org/10.1111/2041-210X.13552</a></p>
Grid-to-Grid daily simulated soil moisture 1964-2018, at selected UK Soil Moisture Databank sites.
<p>This dataset contains Grid-to-Grid (G2G) daily simulated soil moisture time-series at selected UK Soil Moisture Databank (UKSMD) sites. It was created to facilitate an evaluation of G2G simulated soil moisture against the UKSMD neutron probe soil moisture observations (Bell et al., 2022). </p> <p>G2G (Bell et al., 2009) is a national-scale gridded hydrological model, which has been widely applied to simulate river flows and more recently soil moisture. Here, the model was run at 1km resolution from 01/01/1964 - 16/12/2019 across Great Britain. Simulated soil moisture time-series are provided for the 1km grid-cells closest to selected UKSMD site locations. The G2G simulates vertically-integrated soil moisture in units of mm/m. For further explanation of G2G soil moisture, please see Kay et al., 2022 (https://iopscience.iop.org/article/10.1088/1748-9326/ac7a4e). </p> <p>The data is provided as two plain text files:</p> <p>1) g2g_soilmoist_1964_2018.txt contains the simulated soil moisture values. The first three columns specify the simulation date (day, month, year). Subsequent columns are soil moisture (mm/m) time-series at each site, with the UKSMD site ID given as column headers. </p> <p>2) site_locations.csv contains the locations of the UKSMD sites. In some cases there were multiple tubes with slightly different locations within a larger site, and here we are providing the location of the specific tube used. Columns specify: SITE_NAME (the site ID), TUBE_NAME (the tube number), EASTING and NORTHING (easting and northing in British National Grid). The site ID and tube names used in this document are consistent with the UKSMD documentation. </p> <p>References:</p> <p>Bell, V. A., Kay, A. L., Jones, R. G., Moore, R. J., & Reynard, N. S. (2009). Use of soil data in a grid-based hydrological model to estimate spatial variation in changing flood risk across the UK. Journal of Hydrology, 377(3-4), 335-350.</p> <p>Bell, V.A.; Davies, H.N.; Fry, M.; Zhang, T.; Murphy, H.; Hitt, O.; Hewitt, E.J.; Chapman, R.; Black, K.B. (2022). Collated neutron probe measurements and derived soil moisture data, UK, 1966-2013. NERC EDS Environmental Information Data Centre. https://doi.org/10.5285/450bb14b-c711-47af-8792-f9bd88482cd4</p> <p>Kay, A. L., Lane, R. A., & Bell, V. A. (2022). Grid-based simulation of soil moisture in the UK: future changes in extremes and wetting and drying dates. Environmental Research Letters, 17(7), 074029.</p>
All of the same type? The use of 'welfare tourism' to limit the access of EU migrants to social benefits in the UK and Germany 2021
<p><em>List of documents analyzed for book chapter: Gago, Angie (2021) All of the same type? The use of ‘welfare tourism’ to limit the access of EU migrants to social benefits in the UK and Germany </em>In<em> "Social Policy Review 33", edited by Pomati, Marco, Andy Jolly and James Rees, 203-222. Bristol: Bristol University Press, 2021</em></p>
IMPROVER: the new probabilistic post processing system at the UK Met Office: BAMS paper Data
<p>© Crown Copyright, Met Office</p> <p>This is the data associated with the figures in the IMPROVER BAMS paper 2023: <a href="https://doi.org/10.1175/BAMS-D-21-0273.1">https://doi.org/10.1175/BAMS-D-21-0273.1</a>.</p> <p>Gridded data is in CF-NetCDF with reasonably self explanatory metadata, other data such as for Figure 9's wind speed calibration is in CSV.</p>
Datasets for Crop Diversification Study in the UK
<p>Output of analysis for ranking 1820 crops for more that 2700 grid points across the UK. Some areas are missing due to lack of either soil or climate data from UK met office or British Geological Survey. The excel file shows all the primary data that were collected for the highly suitable crops and also the grid that was used for running the analysis. </p>
UK Grid Frequency data in Open-ENF .fredb format
<p>This file contains the mains grid frequency for each second betwen 1st Jan 2014 00:00 UTC and 1st Jan 2022 00:00 UTC. This data was originally published by the UK National Grid, and subsequently cleaned and reformatted in OpenENF .freqdb format</p>
Vertical plant profiles for Dassenbos (NL, 2014-2018, TLS); Wytham Woods (UK, 2022, LEAF) & Northern Australia (2021-2022, LEAF)
<p>This dataset was described and used for the analysis of the following publication:<br> <em>StrucNet: A global network for automated vegetation structure monitoring. Brede, B., Newnham, G., Culvenor, D., Armston, J., Bartholomeus, H., Griebel, A., Hayward, J., Junttila, S., Lau, A., Levick, S., Morrone, R., Origo, N., Pfeifer, M., Verbesselt, J. & Herold, M. Remote Sensing in Ecology and Conservation (accepted)</em></p> <p><strong>Any use of this dataset should cite the paper above </strong>(Creative Commons Attribution 4.0 International Public License).</p> <p>Contact: kim.calders@ugent.be</p> <p> </p> <p>================================================<br> Dataset<br> ================================================</p> <p>1) TLS vertical plant profiles Dassenbos. Five-year dynamics of forest structure for the four sampling locations in Dassenbos. Data were collected using the same measurement protocol and data analysis using https://www.pylidar.org/ as described in Calders et al. (2015) using a zenith range of 35-70 degrees for 184-186 (some scans were discarded for quality purposes) measurement days during the period from February 2014 to November 2018. The data repository contains the vertical plant profiles and plotting code (Fig 1 in paper)</p> <p>2) One-year dynamics of vegetation structure for a tropical savanna site in Northern Australia (Fig 2 in paper) and Wytham Woods (Fig 3 in paper). The data repository contains the vertical plant profiles derived from LEAF data and plotting code.</p>
Understanding levels of online participation in the UK museum sector
<p>This is the corresponding data set for the article "Understanding levels of online participation in the UK museum sector". </p> <p>This data set uses a representative sample of 315 UK museums to create a much-needed benchmark against which museum practitioners can evaluate and contextualise prior studies and their own experiences. It includes data from museum websites and five social media platforms, and is one of the largest data sets of its kind in the European museum sector and the first of such scale in the UK. </p>
Data for: Genetic control of grain amino acid composition in a UK soft wheat mapping population
<p>Wheat is a major source of nutrients for populations across the globe, but the amino acid composition of wheat grain does not provide optimal nutrition. The nutritional value of wheat grain is limited by low concentrations of lysine (the most limiting essential amino acid) and high concentrations of free asparagine (precursor to the processing contaminant acrylamide). There are currently few available solutions for asparagine reduction and lysine biofortification through breeding. In this study, we investigated the genetic architecture controlling grain-free amino acid composition and its relationship to other traits in a Robigus × Claire doubled haploid population. Multivariate analysis of amino acids and other traits showed that the two groups are largely independent of one another, with the largest effect on amino acids being from the environment. Linkage analysis of the population allowed the identification of QTL controlling free amino acids and other traits, and this was compared against genomic prediction methods. Following the identification of a QTL controlling free lysine content, wheat pangenome resources facilitated analysis of candidate genes in this region of the genome. These findings can be used to select appropriate strategies for lysine biofortification and free asparagine reduction in wheat breeding programmes.</p>
URLs with query strings for software in UK Academic Institutional Repositories.
<p>A set of exact URLs containing the query strings to search for software within UK Academic IRs.</p>
Covid-19 UK government, winter 2020, Tiered restrictions data
<p>During the COVID-19 pandemic, several countries took the approach of tiered restrictions. The UK Government’s Winter 2020 Plan looked to take a data driven approach to decision making. They proposed a set of factors (criteria) that would be used to determine what level of restrictions of movement (Tier) should be imposed on different geographical areas in England. Restrictions were tiered from Tier-1 to Tier-4, with Tier-1 being the most relaxed set of restrictions and Tier-4 representing the most constrained level of restrictions. The set of criteria, to determine which Tier from 1 to 4 an area should be placed in were, (1) case detection rate in all age groups, (2) case detection in people aged 60 or above, (3) how quickly case rates were rising or falling, (4) ratio of positive cases in the general population, (5) pressure on the healthcare service. England is geographically made up of 9 Regions which each contains a set of Lower Tier Local Authority (LTLA) areas. Each observation in the dataset denotes information for an LTLA and date pair. For each observation, there is data relating to the values of the set of 5 criteria, for that LTLA, on that day, along with the accompanying Tier value the LTLA was in on that day. Data relating to the set of 5 criteria represent 7-day rolling averages, as a common practice, to alleviate discrepancies in the reporting velocity at different days of the week. For example, it is the case that the number of reported cases around weekends were invariably lower than the cases on other days.</p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.