Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

5,864

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

5,864 results for “species diversity”

Learn how ShareScore rates datasets ↗
zenodo32/100

Figure 4 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 4. Myxicola boki sp. n. A. peristomial notochaeta; B. 4th chaetiger thoracic notochaeta; C. 24th chaetiger abdominal neurochaeta; D, E. 4th chaetiger thoracic uncinus; F–J. 24th chaetiger abdominal uncini, lateral and frontal views.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 7 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 7. Myxicola affinis (YPM IZ 002772.AN). A. entire worm; B, C. peristomial rings, ventral and lateral views, respectively; D. complex of ventral and dorsal lips; E. radiolar tip; F. pygidium; G. scheme of radiolar cross section.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 6 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 6. Myxicola conjuncta (YPM IZ 002773.AN). A. peristomium notochaeta; B. 4th chaetiger thoracic notochaeta; C. 24th chaetiger abdominal neurochaeta; D, E. 4th chaetiger thoracic uncinus; F–H. 24th chaetiger abdominal uncini.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 1 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 1. Myxicola bushae sp. n. A. entire worm; B, C. peristomial ring, ventral and lateral view; D. complex of ventral and dorsal lips; E. radiolar tip; F. pygidium; G. scheme of radiolar cross section.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 3 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 3. Myxicola boki sp. n. A. entire worm; B, C. peristomial ring, ventral and lateral view; D. complex of ventral and dorsal lips; E. radiolar tip; F. pygidium; G. scheme of radiolar section.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 10 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 10. Myxicola affinis (as M. monacis in Chamberlin 1919; MCZ: IZ: ANNb-2170). A. abdominal neurochaeta; B–E. abdominal uncini. Scale bars: 0.02 mm.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 9 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 9. Myxicola affinis (YPM IZ 002772.AN). A. peristomium notochaeta; B. 4th chaetiger thoracic notochaeta; C. 24th chaetiger abdominal neurochaeta; D–F. 4th chaetiger thoracic uncinus, lateral (2) and front views, respectively; G–I. 24th chaetiger abdominal uncini. Scale bars: 0.02 mm.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 2 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 2. Myxicola bushae sp. n. A. peristomium notochaeta; B. 4th chaetiger thoracic notochaeta; C. 24th chaetiger abdominal neurochaeta; D–F. 4th chaetiger thoracic uncinus, lateral and frontal view; G–J. 24th chaetiger abdominal uncini, lateral and frontal views. Scale bars: 0.02 mm.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 6 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 6. Myxicola conjuncta (YPM IZ 002773.AN). A. peristomium notochaeta; B. 4th chaetiger thoracic notochaeta; C. 24th chaetiger abdominal neurochaeta; D, E. 4th chaetiger thoracic uncinus; F–H. 24th chaetiger abdominal uncini. Scale bars: 0.02 mm.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 3 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 3. Myxicola boki sp. n. A. entire worm; B, C. peristomial ring, ventral and lateral view; D. complex of ventral and dorsal lips; E. radiolar tip; F. pygidium; G. scheme of radiolar section. (r.a: radiolar appendages)

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 1 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 1. Myxicola bushae sp. n. A. entire worm; B, C. peristomial ring, ventral and lateral view; D. complex of ventral and dorsal lips; E. radiolar tip; F. pygidium; G. scheme of radiolar cross section. (g: glandular girdle, barely visible; p.e: pygidial eyes)

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 4 in The forgotten diversity of the genus Myxicola (Polychaeta: Sabellidae) in North America: redescription of historical taxa and description of two new species

Figure 4. Myxicola boki sp. n. A. peristomial notochaeta; B. 4th chaetiger thoracic notochaeta; C. 24th chaetiger abdominal neurochaeta; D, E. 4th chaetiger thoracic uncinus; F–J. 24th chaetiger abdominal uncini, lateral and frontal views. Scale bars: 0.02 mm

opennotspecifiedAug 2024View details →
zenodo32/100

Data for: Detection and diversity of Phytophthora species from declining Quercus suber stands using both DNA metabarcoding and soil baiting techniques

<p>This dataset on Zenodo accompanies the manuscript Salvatore <em>et al.</em> (2024), Detection and diversity of <em>Phytophthora</em> species from declining <em>Quercus suber</em> stands using both DNA metabarcoding and soil baiting techniques.</p> <p>There are two files here on Zenodo:</p> <ul> <li><code>metadata.tsv</code>&nbsp;- plain text table as tab-separated variables</li> <li><code>raw_data.tar.gz</code> - compressed archive of 56 paired raw FASTQ files</li> </ul> <p>This represents a subset of one complete Illumina Nano MiSeq plate run at the James Hutton Institute also containing a small number of unrelated samples using the same protocol.</p> <p>To repeat the analysis described in the paper, first install THAPBI PICT. See <a href="https://github.com/peterjc/thapbi-pict/">https://github.com/peterjc/thapbi-pict/ </a>for instructions. At the time of the paper, v1.0.16 was the current release.</p> <p>Next, decompress the raw data into a folder of paired gzipped FASTQ files. There is no need to decompress those:</p> <pre><code> $ tar -zxvf raw_data.tar.gz</code><br><code> $ ls -1 raw_data/</code></pre> <p>If you wish, verify the checksums to confirm the data integrity:</p> <pre><code> $ cd raw_data/ &nbsp; $ md5sum -c MD5SUM.txt</code><br><code> $ cd ..</code></pre> <p>Setup output directories:</p> <pre><code> &nbsp; $ mkdir -p intermediate/ summary/</code></pre> <p>Run the THAPBI PICT pipeline:</p> <pre><code> &nbsp; $ thapbi_pict pipeline -m 1s3g -f 0 -a 15 -i raw_data/ \</code><br><code> -s intermediate/ -o summary/sardinia \</code><br><code> -t metadata.tsv -u -x 8 -c 4,5,3,2,7,6</code></pre> <p>The options here are as follows:</p> <ul> <li><code>-m</code> - use the 1s3g classifier (see methods)</li> <li><code>-f</code> - set to zero to disable the fractional abundance threshold</li> <li><code>-a</code> - set a lower absolute abundance threshold</li> <li><code>-i</code> - location of the input raw data</li> <li><code>-s</code> - optional location to store intermediate files</li> <li><code>-o</code> - output stem for reports</li> <li><code>-t</code> - filename for tab-separated-variable metadata</li> <li><code>-u</code> - show unsequenced samples defined in the metadata</li> <li><code>-x</code> - which metadata column contains Illumina FASTQ filename stems</li> <li><code>-c</code> - which metadata columns to include in the report.</li> </ul> <p>This leaves the <code>-d</code> option with the default provided ITS1 database. We are NOT taking advantage of the negative controls to automatically set a blanket minimum abundance as Control-Plate-3-Mix-3-Dry-P3-c_S56_L001 sadly has over 3000 <em>Phytophthora</em> reads.</p> <p>That takes under a minute to run, and classifies most of the samples.</p> <p>Opening the output file <code>summary/sardinia_20240912_v1.0.16.ITS1.samples.1s3g.xlsx</code> in Excel or similar should show you a table resembling Table 3 in the paper, without the baiting results, but with one row per sequencing sample, and additional columns with per-sample per-species read counts etc. The similarly named reads file as one row per unique amplicon sequence variant (ASV), and columns for each sequencing sample.</p> <p>All the <em>Phytophthora</em> classifications were to species level except a single ASV from E5BTB-DILUTE-Wet-P6_S17_L001 (S3 &nbsp;Bultei) with 15 reads, a perfect match to partial sequences MH588088.1 and MH593844.1, isolates Y1 and Y2, which is in the THAPBI PICT database but only at genus level:</p> <pre><code>&gt;bad82a53fff502146e7ea00cbf2d9d3e Phytophthora<br>TTTCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCTAAAACTTTCCACGTGAACCGTTTCAAACCAAATAGTTGGGGGTCTTGTCTGGTGGCGGCTGCTGGCTTTATTGTTGGCGGCTGCTGCTGGGTGAGCCCTATCATGGCGAGCGTTTGGGCTTCGGCCTGAGCTAGTAGCATTTCTTTTAAACCCATTCCTTAATACTGATTATACT</code></pre> <p>There are 9 samples left simply as "Unknown" (all six from S2 Buddus&ograve;, one each from S3 Bultei, S4 Nuoro, and S6 Tempio). A further two samples contained low levels of an unknown sequence in addition to knowns.</p> <p>The unknown ASV from S1BTC-DILUTE-Wet-P6_S9_L001 (S3 Bultei) looks to be a novel <em>Phytophthora</em> if real, similar to&nbsp;<em>P. quercina</em>:</p> <pre><code>&gt;3cd110db0a0b8fa8b971ea6b61c53970 Phytophthora?<br>TTTCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCTAAAAAACTTTCCACGTGAACCGTTTCAACCAATATTTTGGGGGTCTCGTCTGGCGTGCGGCTGTTGCTGTAAAAGGCGGCGGCTGTTGCTGGGTGAGCCCTATCATGGCAAACGTTTGGGCTTCGGTCTGAACAAGTAGCTCTTTTTTAAACCATTACTTATTACTGATTATACT</code></pre> <p>The unknown ASV from S4OC-DILUTE-Wet-P6_S2_L001 (S4 Nuoro) looks to be a <em>Pythium</em> (a perfect match to partial sequences MN269744 and KY822489 from uncultured clones):</p> <pre><code>&gt;eac8c1931b4f8c57803e6ad9ffb4eb56 Pythium?<br>TTTCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCAAAAAACTATCCACGTGAACCGTTAAGCAAAAGTCTAGTTGGCTTGTGTTGTTCGGGAGTGTGTTGGGAAGAGCTTGGAGATGTCTTCGGATATTTCGATGCCTAGTACTGGACATCCTGGCGAGCGAGTCGGCTAGCAACGAAGGTCGGGAGTTCGCTTGCGGACTGATGTGCGCTTGTCGCATGTCGGTCGAAAGGCTTGAGCAAACGGCTGATCTATTACTTTTAAACCATACCATAACTACTGATGATACT</code></pre> <p>The unknown ASV from S9OC-Wet-P5_S12_L001 (S4 Nuoro) at only 38 reads seems to be an artefact of some kind, possibly chimeric:</p> <pre><code>&gt;74933d826f6077cd5f3dd036f894429d Artefact?<br>TAGCCGTAGGGGAACCTGCGGCTGGATCACCTCCTTTCTGGATTCGGAAGGCAGGGATCAGTGATCAGTTATCAGAACCGATTGCTGCTCCTCTTCCGAGCATCCACAACGCCAGCTCTGGCAGGAATTCTGATATCTGATATCTGGTTTCTGCGATCTGGCAACGGCGCCGCCGTCTGCGCATCCCTTCTGCCGCGTTATTCCAGAGGGCAGTGATCAGTCATCAGAACCGATGGCGGATCCGCCCCCGGCTTCACGGCGAGCGCCCGAGCCTG</code></pre> <p>The remaining unknown ASVs were likely <em>Plasmopara</em>.</p> <p>&nbsp;</p>

opencc-by-4.0Sep 2024View details →
zenodo32/100

TABLE 2 in Morphology and molecular evidence reveal hidden diversity among snapping shrimp of the Alpheus obesomanus group (Decapoda: Alpheidae) with the description of a new species from Brazil

<p><b>TABLE 2.</b> Characters used to differentiate <i>Alpheus coralvivo</i> <b>sp. nov.</b> from the morphologically similar <i>Alpheus</i> Fabricius, 1798 species. *Mostly based on the comparative material cited in Appendix 1 and **based on the comparative material, illustrations, and description provided by Holthuis (1980).</p><table><tbody><tr><th>Characters/Species</th><th><i>Alpheus coralvivo</i> <b>sp. nov</b>.</th><th><i>Alpheus simus *</i></th><th><i>Alpheus saxidomus **</i></th></tr></tbody><tbody><tr><th>Rostrum Relative length of the second article of antennular peduncle</th><td>Absent Approx. 4 times as long as visible part of first article</td><td>Absent Around 3 times as long as visible part of first article</td><td>Absent or vestigial Approx. 2.5 times as long as visible part of first article</td></tr><tr><th>Propodus spines (excluding distal pair)</th><td>4&ndash;6</td><td>3&ndash;4</td><td>5&ndash;6</td></tr><tr><th>Shape of distolateral spiniform seta of uropodal exopod</th><td>Slender</td><td>Slender</td><td>Stout</td></tr><tr><th>Colour of distolateral spiniform seta uropodal exopod</th><td>Dark brown, black or not pigmented</td><td>Not pigmented</td><td>Dark brown or black</td></tr><tr><th>Diaeresis Depth</th><td>Absent 1&ndash;12 m</td><td>Absent 2&ndash;146 m</td><td>Present 2&ndash;12 m</td></tr><tr><th>Distribution</th><td>Northwestern Brazil (Rio Grande do Norte and Bahia)</td><td>South Florida to Caribbean Sea</td><td>Eastern Pacific (Costa Rica, Panama south to Colombia and Galapagos)</td></tr></tbody></table>

opennotspecifiedJun 2024View details →
zenodo32/100

TABLE 1 in Morphology and molecular evidence reveal hidden diversity among snapping shrimp of the Alpheus obesomanus group (Decapoda: Alpheidae) with the description of a new species from Brazil

<p><b>TABLE 1.</b> List of specimens of <i>Alpheus</i> Fabricius, 1798 and <i>Synalpheus</i> Spence Bate, 1888 used in the genetic analyses with cytochrome oxidase subunit I gene. Abbreviations: Atl, Atlantic Ocean; BA, Bahia; Pac, Pacific Ocean; SP, S&atilde;o Paulo.</p><table><tbody><tr><th><b>Species</b></th><th><b>Locality</b></th><th><b>Gene Bank or Bold number</b></th><th><b>Reference</b></th></tr></tbody><tbody><tr><th><i>Alpheus armatus</i> Rathbun, 1901</th><td>Caribbean Sea</td><td>KF131481</td><td>Hurt <i>et al</i>. (2013)</td></tr><tr><th><i>Alpheus coralvivo</i> <b>sp. nov.</b></th><td>Brazil (BA)</td><td>MT483210&ndash;MT483212</td><td>Present study</td></tr><tr><th><i>Alpheus formosus</i> Gibbes, 1850</th><td>USA</td><td>KP254069</td><td>Leray &amp; Knowlton (2015)</td></tr><tr><th><i>Alpheus idiocheles</i> Couti&egrave;re, 1905</th><td>French Polynesia</td><td>MBMIA293-06 MBMIA294-06</td><td>No reference</td></tr><tr><th><i>Alpheus immaculatus</i> Knowlton &amp; Keller, 1983</th><td>Caribbean Sea</td><td>KF131503</td><td>Hurt <i>et al</i>. (2013)</td></tr><tr><th><i>Alpheus lottini</i> Gu&eacute;rin-M&eacute;neville, 1838</th><td>New Caledonia</td><td>KY746843 KY746844</td><td>Rouz&eacute; <i>et al</i>. (2017)</td></tr><tr><th><i>Alpheus malleator</i> Dana, 1852</th><td>Panama (Atl)</td><td>FJ013923</td><td>Hurt <i>et al</i>. (2009)</td></tr><tr><th><i>Alpheus malleodigitus</i> (Spence Bate, 1888)</th><td>French Polynesia</td><td>MBMIA627-06 MBMIA628-06</td><td>No reference</td></tr><tr><th><i>Alpheus obesomanus</i> Dana, 1852</th><td>French Polynesia</td><td>MBMIA360-06 MBMIA361-06 MBMIA402-06</td><td>No reference</td></tr><tr><th><i>Alpheus polystictus</i> Knowlton &amp; Keller, 1985 Caribbean Sea</th><td>KF131508</td><td>Hurt <i>et al</i>. (2013)</td></tr><tr><th><i>Alpheus roquensis</i> Knowlton &amp; Keller, 1985</th><td>Venezuela</td><td>KF131529 KF131530</td><td>Hurt <i>et al</i>. (2013)</td></tr><tr><th><i>Alpheus saxidomus</i> Holthuis, 1980</th><td>Panama (Pac)</td><td>FJ013929&ndash;FJ013933</td><td>Hurt <i>et al</i>. (2009)</td></tr><tr><th><i>Alpheus simus</i> Gu&eacute;rin-M&eacute;neville, 1855</th><td>Panama (Atl)</td><td>FJ013945 FJ013946 FJ013948</td><td>Hurt <i>et al</i>. (2009)</td></tr><tr><th><i>Synalpheus fritzmuelleri</i> Couti&egrave;re, 1909</th><td>Jamaica</td><td>KJ595081</td><td>Hultgren <i>et al</i>. (2014)</td></tr><tr><th><i>Synalpheus townsendi</i> Couti&egrave;re, 1909</th><td>Brazil (SP)</td><td>KU313018</td><td>Almeida <i>et al</i>. (2018)</td></tr></tbody></table>

opennotspecifiedJun 2024View details →
zenodo32/100

FIGURE 2 in Diversity of Gyroporus (Gyroporaceae, Boletales): rpb2 phylogeny and three new species

FIGURE 2. Gyroporus madagascariensis sp. nov. basidiocarps. Counterclockwise from bottom-left: Buyck 08.211 (holotype); Buyck 08.211 (holotype), hymenophore view; Buyck 08.202, hymenophore view; Buyck 08.202. Images: Bart Buyck.

opennotspecifiedMar 2020View details →
zenodo32/100

FIGURE 3 in Diversity of Gyroporus (Gyroporaceae, Boletales): rpb2 phylogeny and three new species

FIGURE 3. Gyroporus borealis sp. nov. Specimen NY1393558 (holotype). Top: hymenophore view. Bottom: pileus view. Images: Terrence Delaney.

opennotspecifiedMar 2020View details →
zenodo32/100

FIGURE 5 in Integrative approach reveals underestimated Peyssonneliales diversity in Brazil: registering the first occurrence of Ramicrusta and Incendia, with the description of three new species

FIGURE 5. Maximum likelihood (ML) tree of COI-5P. Bootstrap values (BP) and posterior probabilities (PP) are shown at the nodes BP/PP. Samples generated in this study are in bold; – indicates lack of bootstrap support or values under 75; * indicates full support. Inset displays ABGD reconstructions.

opennotspecifiedApr 2020View details →
zenodo32/100

FIGURE 6 in Integrative approach reveals underestimated Peyssonneliales diversity in Brazil: registering the first occurrence of Ramicrusta and Incendia, with the description of three new species

FIGURE 6. Maximum likelihood (ML) tree of SSU. Bootstrap values (BP) and posterior probabilities (PP) are shown at the nodes BP/PP. Samples generated in this study are in bold; – indicates lack of bootstrap support or values under 75; * indicates full support.

opennotspecifiedApr 2020View details →
zenodo32/100

FIGURE 1 in Integrative approach reveals underestimated Peyssonneliales diversity in Brazil: registering the first occurrence of Ramicrusta and Incendia, with the description of three new species

FIGURE 1. Incendia yoneshigueana. (A) Habit. (B) Radial vertical section of thallus, evidencing perithallus. (C) Upper perithallus. (D) Multicellular rhizoids. Basal cell partially embedded in hypobasal cuticle (arrows). (E) Radial cellular projections in lower perithallus connected by secondary pit connections (arrows). (F) Radial cellular projections in lower perithallus (arrows). Scale bar: A, 1 cm; B, 100 μm; C, D, E and F, 30 μm.

opennotspecifiedApr 2020View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record