Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

2,785

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

2,785 results for “Genotype”

Learn how ShareScore rates datasets ↗
dryad36/100

Hybridization alters the shape of the genotypic fitness landscape, increasing access to novel fitness peaks during adaptive radiation

<p>Estimating the complex relationship between fitness and genotype or phenotype (i.e. the adaptive landscape) is one of the central goals of evolutionary biology. However, adaptive walks connecting genotypes to organismal fitness, speciation, and novel ecological niches are still poorly understood and processes for surmounting fitness valleys remain controversial. One outstanding system for addressing these connections is a recent adaptive radiation of ecologically and morphologically novel pupfishes (a generalist, molluscivore, and scale-eater) endemic to San Salvador Island, Bahamas. We leveraged whole-genome sequencing of 139 hybrids from two independent field fitness experiments to identify the genomic basis of fitness, estimate genotypic fitness networks, and measure the accessibility of adaptive walks on the fitness landscape. We identified 132 SNPs that were significantly associated with fitness in field enclosures. Six out of the 13 regions most strongly associated with fitness contained differentially expressed genes and fixed SNPs between trophic specialists; one gene (<em>mettl21e</em>) was also misexpressed in lab-reared hybrids, suggesting a potential intrinsic genetic incompatibility. We then constructed genotypic fitness networks from adaptive alleles and show that scale-eating specialists are the most isolated of the three species on these networks. Intriguingly, introgressed and<em> de novo</em> variants reduced fitness landscape ruggedness as compared to standing variation, increasing the accessibility of genotypic fitness paths from generalist to specialists. Our results suggest that adaptive introgression and <em>de novo</em> mutations alter the shape of the fitness landscape, providing key connections in adaptive walks circumventing fitness valleys and triggering the evolution of novelty during adaptive radiation.</p>

opencc-zeroJul 2022View details →
dryad36/100

SolCAP 8K array genotyping of population 15143

<p><span></span></p> <p>The dataset is a tab-deliminted text file with genotyping information for a diploid potato progeny population derived from a cross of diploid potato clones 12120-03 X 07506-01. The SolCap 8303 Infinium Chip was used for SNP genotyping.  It was originally generated for study on genetic mapping of Verticillium wilt resistance.  The data was used again for analysis of segregation distortion in the most recent manuscript.  </p>

opencc-zeroJul 2022View details →
dryad36/100

Microsatellite genotypes for temporal monitoring of the Floreana Island Galapagos Giant Tortoise captive breeding program

<p><span>Captive breeding programs benefit from genetic analyses that identify relatedness between individuals, assign parentage to offspring, and track levels of genetic diversity. Monitoring these parameters across breeding cycles is critical to the success of a captive breeding program as it allows conservation managers to iteratively evaluate and adjust program structure. However, in practice, genetic tracking of breeding outcomes is rarely conducted. Here, we examined the first three offspring cohorts (2017 – 2020) of the genetically-informed captive breeding program for the Floreana Island Galapagos giant tortoise, </span><em><span>Chelonoidis niger</span></em><span>. This captive breeding program is unique as the Floreana tortoise has been extinct since the 1800s, but its genome </span><span>persists, in part, in the form of living hybrids with the extant Volcano Wolf tortoise, <em>Chelonoidis becki</em>. Breeding over the study period took place at the Galapagos National Park Directorate breeding facility in four corrals, each containing three females and two males. Using 17 microsatellite markers, we were able to assign parentage to 94 of the 98 offspring produced over the study period. </span><span>We observe that despite the addition of more founders since the pilot breeding program, the effective population size remains low, and changes to the arrangements of breeding corrals may be necessary to encourage more equal reproductive output from the males. </span><span>This study demonstrates the value of hybrids for species restoration and the importance of continually reassessing the outcomes of captive breeding. </span></p>

opencc-zeroAug 2022View details →
dryad36/100

Data from: Hybrid enrichment of adaptive variation revealed by genotype-environment associations in montane sedges

<p>The role of hybridization in diversification is complex and may result in many possible outcomes. Not only can hybridization produce new lineages, but those lineages may contain unique combinations of adaptive genetic variation derived from parental taxa that allow hybrid-origin lineages to occupy unique environmental space relative to one (or both) parents. We document such a case of hybridization between two sedge species, <em>Carex</em> <em>nova</em> and <em>Carex</em> <em>nelsonii</em> (Cyperaceae), that occupy partially overlapping environmental space in the southern Rocky Mountains, USA. In the region hypothesized to be the origin of the hybrid lineage, one parental taxon (<em>C. nelsonii</em>) is at the edge of its environmental tolerance. Hybrid-origin individuals display mixed ancestry between the parental taxa – of nearly 7,000 unlinked loci sampled, almost 30% showed evidence of excess ancestry from one parental lineage – approximately half displayed a genomic background skewed towards one parent, and half skewed towards the other. To test whether excess ancestry loci may have conferred an adaptive advantage to the hybrid-origin lineage, we conducted genotype-environment association analyses on different combinations of loci – with and without excess ancestry – and with multiple contrasts between the hybrids and parental taxa. Loci with skewed ancestry showed significant environmental associations distinguishing the hybrid lineage from one parent (<em>C. nelsonii</em>), whereas loci with relatively equal representation of parental ancestries showed no such environmental associations. Moreover, the overwhelming majority of candidate adaptive loci with respect to environmental gradients also had excess ancestry from a parental lineage, implying these loci have facilitated the persistence of the hybrid lineage in an environment unsuitable to at least one parent<em>.</em></p>

opencc-zeroAug 2022View details →
zenodo36/100

Illumina HD genotypes for 3,092 cattle from Burkina Faso, Ghana, Nigeria and Tanzania for: "Assessment of genotyping array performance for genome-wide association studies and imputation in African cattle"

<p>Raw HD data for Riggio&nbsp;et al. 2022:&nbsp;Assessment of genotyping array performance for genome-wide association studies and imputation in African cattle</p> <p>This repository contains the raw Illumina HD genotypes (i.e., 777,962 SNPs) mapped to the bovine UMD3.1 genome assembly for 3,092 animals from four African countries (namely Burkina Faso, Ghana, Nigeria and Tanzania).&nbsp;</p>

opencc-by-4.0Jul 2022View details →
zenodo36/100

E. coli-ΦX174 genotype to phenotype map reveals flexibility and diversity in LPS structures

<p>Here are the raw sequencing data of all <em>E. coli</em> C and &Phi;X174 strains obtained during this study. A short description of each file&#39;s content can be found below.</p> <p>&nbsp;</p> <p><em>Bacteria</em></p> <ul> <li>&quot;E.coliC_res.zip&quot;: Whole genome sequencing results of <em>E. coli</em> C WT and &Phi;X174-resistant strains (generated by fluctuation experiments). All<em> E. coli</em> C samples were prepared for whole-genome sequencing from one millilitre of stationary-phase cultures. Genomic DNA was extracted using the Wizard&reg; Genomic DNA purification Kit (Promega, Germany). Bacterial samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Pl&ouml;n, Germany) using an Illumina Nextera DNA Flex Library Prep Kit to produce 150 bp paired-end reads.</li> </ul> <p>&nbsp;</p> <ul> <li>&quot;E.coliC_res_excluded.zip&quot;: Whole genome sequencing results of the four &Phi;X174-resistant <em>E. coli</em> C strains (generated by fluctuation experiments) that have been excluded from the analyses<em>: E. coli </em>C R1, R3, R15, and R19. We found that both<em> E. coli</em> C R3 and R15 were not isogenic. While whole-genome sequencing from their respective glycerol stocks showed only a single mutation in <em>galE</em>, whole-genome sequencing carried on colony re-streaks showed that additional mutations were systematically associated with the single mutation in <em>galE</em> (<strong>see file &quot;E.coliC_res_excluded_10_clones</strong>). <em>E. coli</em> C R1 displayed an unstable resistant phenotype. Finally, <em>E. coli</em> C R19 was partially resistant to &Phi;X174 WT. It carries a single mutation in the <em>yajC</em> gene, which encodes for a periplasmic protein. No apparent link to the LPS biosynthesis or assembly has been discovered yet, but <em>yajC</em> might play a role in phage DNA injection into the bacterium&rsquo;s cytoplasmic membrane.</li> </ul> <p>&nbsp;</p> <ul> <li>&quot;E.coliC_res_excluded_10_clones.zip&quot;: Whole genome sequencing results of 10 randomly chosen isolates of<em> E. coli </em>C R1, R3, and R15.</li> </ul> <p>&nbsp;</p> <ul> <li>&quot;EcoliC.gb&quot;: <em>E. coli</em> C WT strain used as reference.</li> </ul> <p>&nbsp;</p> <p><em>Bacteriophages</em></p> <p>&nbsp;</p> <ul> <li>&ldquo;PhiX174_PCR_399r_400f.zip&rdquo;: &Phi;X174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5&reg; High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of &Phi;X174 whole genome are:</li> </ul> <p>&nbsp;</p> <p>PhiX174_399_r: CTTGACTCATGATTTCTTACC</p> <p>PhiX174_400_f: TTACTGAACAATCCGTACGTTTC</p> <p>&nbsp;</p> <p>DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Pl&ouml;n, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads.</p> <p>&nbsp;</p> <ul> <li>&ldquo;PhiX174_PCR_2361r_2362f.zip&rdquo;: &Phi;X174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5&reg; High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of &Phi;X174 whole genome are:</li> </ul> <p>&nbsp;</p> <p>PhiX174_2361_r: TCGCTTGGTCAACCCCTCAG</p> <p>PhiX174_2362_f: AGCGCGGTAGGTTTTCTGCT</p> <p>&nbsp;</p> <p>DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Pl&ouml;n, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads.</p> <ul> <li>&ldquo;PhiX174_excluded.zip&rdquo;: Since we removed R19 from the final analysis, we also removed its corresponding evolved phage obtained during the first evolution experiment (&Phi;X174 R19 T1). We also removed the phage infecting R5 (&Phi;X174 R5 T2) because it was not isogenic (confirmed by Sanger Sequencing).</li> </ul> <ul> <li>&ldquo;PhiX174_Sequencing_Sanger.zip&rdquo;: Both <em>F</em> and <em>H</em> genes were amplified by performing 35 cycles of PCR using Phusion&reg; High-Fidelity PCR Master Mix with HF Buffer. The sequencing primers are listed in the<strong> Information_Sanger_Samples_ID.xlsx</strong> file.</li> </ul> <p>&nbsp;</p> <ul> <li>&ldquo;PhiX174_ref.gb&rdquo;: PhiX174 WT strain used as reference.</li> </ul> <p>&nbsp;</p> <p>We also include the raw data and pictures from our spotting tests and plaque assays used to complete the final matrix of infection.</p> <ul> <li>Spotting_tests_reanalyzed.xlsx&rdquo;: Raw data from the pictures (see <strong>Photos_matrices</strong><strong>.zip</strong>) used to generate the Hierarchical agglomerative clustering analysis of the host ranges of evolved phage and Infection matrix of evolved &Phi;X174 phages on the 31 resistant E. coli C strains.</li> </ul> <p>The <strong>Photos_matrices</strong><strong>.zip</strong> folder contains</p> <p>&nbsp;</p> <ul> <li>&ldquo;SSA_matrix_Bact_Lawn&rdquo;: pictures of all evolution experiments obtained from the spotting test method where we spotted phages on bacterial lawns.</li> </ul> <p>&nbsp;</p> <ul> <li>&ldquo;SSA_matrix_Phi_Lawn&rdquo;: pictures of all evolution experiments obtained from the spotting test method where we spotted bacteria on phage lawns.</li> </ul> <p>&nbsp;</p> <ul> <li>&ldquo;Mismatches&rdquo;: We performed plaque assays when combinations of phages and bacteria showed discrepancies between the two spotting test methods</li> </ul> <p>&nbsp;</p> <ul> <li>&ldquo;Plaque_assays_R12_R14&rdquo;: pictures of plaque assays where we tested the sensitivity of <em>E. coli</em> C R12 and R14 toward a subset of evolved phages</li> </ul> <p>&nbsp;</p> <ul> <li>&ldquo;Plaque_assays_of_PhiX174R22T1c1/R28T1c1_vs_WT&rdquo;: pictures of plaque assays where we tested the sensitivity of <em>E. coli</em> C WT toward phages infecting R22 and R28.</li> </ul> <p>&nbsp;</p> <ul> <li>&ldquo;displayImage.R&rdquo;. Script made to look for the desired combination of phage and bacterium.</li> </ul> <p>&nbsp;</p> <p>Finally, we include the raw OD measurments:</p> <p>&nbsp;</p> <ul> <li>&ldquo;All_EcoliC_growth_raw_data.xlsx&rdquo;: raw OD measurements of each <em>E. coli</em> C resistant strains used in this study.</li> </ul>

opencc-by-4.0Sep 2022View details →
dryad36/100

Dataset for: Guidelines for standardising the application of discriminant analysis of principal components to genotype data

<p><span>Data and scripts required to replicate the analyses in Thia (2022) "<span class="fontstyle0">Guidelines for standardising the application of discriminant analysis of principal components to genotype data" in <em>Molecular Ecology</em>.</span></span></p> <p><span>This study aimed to address methodological misunderstandings and misuse of the DAPC method in population genetics. The analyses are used to illustrate that for genotype data comprising <em>k</em> effective populations, there are only <em>k</em><span>−</span>1 PC axes that describe populations structure, and that are biologically informative. These PC axes are the only suitable axes for modelling the among-population differences with a DA. Use of many more than <em>k</em><span>−1 PC axes leads to decreasing biological relevancy of the final DA solution, with implications for misinterpretations of population structure.</span></span></p>

opencc-zeroSep 2022View details →
dryad36/100

CGG short tandem repeat genotype predictions

<p>As expansions of CGG short tandem repeats (STR) are established as the genetic aetiology of many neurodevelopmental disorders, we aimed to elucidate the inheritance patterns and role of CGG STRs in autism-spectrum disorder (ASD). By genotyping 6,063 CGG STR loci in a large cohort of trios and quads with an ASD-affected proband, we determined an unprecedented rate of CGG repeat length deviation across a single generation. While the concept of repeat length being linked to deviation rate was solidified, we demonstrate how shorter STRs display greater degrees of size variation. We observed that CGG STRs did not segregate by Mendelian principles, with a bias against longer repeats, which appeared to magnify as repeat length increased. Through logistic regression, we identified 19 genes that displayed significantly higher rates and degrees of CGG STR expansion within the ASD-affected probands (p &lt; 1 x 10<sup>-5</sup>). This study not only highlights novel repeat expansions that may play a role in ASD but also reinforces the hypothesis that CGG STRs are specifically linked to human cognition.</p>

opencc-zeroOct 2022View details →
zenodo36/100

New methods for the genotyping of Legionella pneumophila - Establishment, validation and implementation of a DNA-based microarray and a core genome multilocus sequence typing

<p>This data presented here are part a doctoral thesis with the focus on new genotyping methods for the human pathogen <em>Legionella pneumophila</em>. The data are partially published in articles.&nbsp;</p> <p>The thesis can be downloaded: update of the URL is coming soon</p>

opencc-by-4.0Sep 2013View details →
dryad36/100

Variation and plasticity in life-history traits and fitness of wild Arabidopsis thaliana populations are not related to their genotypic and ecological diversity

<p>Despite its implications for population dynamics and evolution, the relationship between genetic and phenotypic variation in wild populations remains unclear. Here, we estimated variation and plasticity in life-history traits and fitness of the annual plant <em>Arabidopsis thaliana</em> in two common garden experiments that differed in environmental conditions. We used up to 306 maternal inbred lines from six Iberian populations characterized by low and high genotypic (based on whole-genome sequences) and ecological (vegetation type) diversity. Low and high genotypic and ecological diversity was found in edge and core Iberian environments, respectively. Given that selection is expected to be stronger in edge environments and that ecological diversity may enhance both phenotypic variation and plasticity, we expected genotypic diversity to be positively associated with phenotypic variation and plasticity. However, maternal lines, irrespective of the genotypic and ecological diversity of their population of origin, exhibited a substantial amount of phenotypic variation and plasticity for all traits. Furthermore, all populations harbored maternal lines with canalization (robustness) or sensitivity in response to harsher environmental conditions in one of the two experiments. Overall, we conclude that the environmental attributes of each population probably determine their genotypic diversity, but all populations maintain substantial phenotypic variation and plasticity for all traits, which represents an asset to endure in changing environments.</p>

opencc-zeroApr 2024View details →
dryad36/100

EST-SSR genotyping data from: Ecotype variation in the endemic tree Callicarpa subpubescens on small oceanic islands: Genetic, phenotypic, and environmental insights

<p><em>Callicarpa subpubescens</em>, endemic to the Ogasawara Islands, is suggested to have multiple ecotypes in the Hahajima Islands, specifically in the central part of the Ogasawara Islands. In this study, associations between genetic groups and spatial distribution, habitat, leaf morphology, size structure, and flowering time of each genetic group were investigated on Hahajima and the satellite Imoutojima Islands. Genetic groups were identified using EST-SSR markers, revealing four ecotypes named based on morphological features: Dwarf (D), Glabrescent (G), Tall (T), and Middle (M), with M being a result of the hybridization of G and T. Ecotype D, adapted to dry environments, is characterized by small tree size, dense thick leaves with abundant hairs, and is distributed in dry scrub. Ecotype G, adapted to understory of mesic forests, lacks leaf hairs. Ecotype T, adapted to the canopy of mesic forests, has hairy leaves and is tall in tree height. Ecotype M, adapted to the canopy of mesic scrub or edges of mesic forests, has hairy leaves but with a shorter tree height than ecotype T. Flowering peaks differed among all ecotype pairs except G and M, but the flowering times more or less overlapped among all ecotypes, suggesting that pre-mating isolation among ecotypes is not perfect. Post-mating isolation is considered absent, as there were no differences in the results, germination, and survival rates of one-year seedlings among inter- and intra-ecotype crossings. The existence of such ecotypes provides valuable insights into the ongoing speciation processes adapting to the oceanic island environments.</p>

opencc-zeroApr 2024View details →
zenodo36/100

Differentially methylated genes involved in reproduction and ploidy levels in recent diploidized and tetraploidized Eragrostis curvula genotypes

<p>Epigenetics studies changes in gene activity without changes in the DNA sequence. Methylation is an epigenetic mechanism important in many pathways, such as biotic and abiotic stresses, cell division, and reproduction.&nbsp;<em>Eragrostis curvula</em>&nbsp;is a grass species reproducing by apomixis, a clonal reproduction by seeds. This work employed the MCSeEd technique to identify deferentially methylated positions, regions, and genes in the CG, CHG, and CHH contexts in&nbsp;<em>E</em>.&nbsp;<em>curvula</em> genotypes with similar genomic backgrounds but with different reproductive modes and ploidy levels. In this way, we focused the analysis on the cvs. Tanganyika INTA (4x, apomictic), Victoria (2x, sexual), and Bahiense (4x, apomictic). Victoria was obtained from the diploidization of Tanganyika INTA, while Bahiense was produced from the tetraploidization of Victoria. This study showed that polyploid/apomictic genotypes had more differentially methylated positions and regions than the diploid sexual ones. Interestingly, it was possible to observe fewer differentially methylated positions and regions in CG than in the other contexts, meaning CG methylation is conserved across the genotypes regardless of the ploidy level and reproductive mode. In the comparisons between sexual and apomictic genotypes, we identified differentially methylated genes involved in the reproductive pathways, specifically in meiosis, cell division, and fertilization. Another interesting observation was that several differentially methylated genes between the diploid and the original tetraploid genotype recovered their methylation status after tetraploidization, suggesting that methylation is an important mechanism involved in reproduction and ploidy changes.</p>

opencc-by-4.0Dec 2023View details →
zenodo36/100

Differential methylation patterns in apomictic vs. sexual genotypes of the diplosporous grass Eragrostis curvula.

<p>Methylation is an epigenetic mechanism where a methyl group take place over the C5 of cytosine or C6 of adenine repressing or de-repressing genes depending on the context, position (coding or non-coding) and species. Eragrostis curvula is a forage grass that reproduces by apomixis. Increases of the frequency of sexual pistils in facultative genotypes of this grass has been associated to epigenetic changes triggered by different biotic and abiotic stresses. The aim of the present study was to associate differences in the reproductive mode with specific methylated regions and genes contrasting full apomictic, facultative and sexual genotypes using the methylation sensitive technique MCSeEd. The distribution of the differentially methylated positions over the genes shows a peak around the start and stop codon boundaries, hence regulating gene expression mainly through the incorporation of methyl groups on these positions. The main pathways being regulated were ubiquitin and auxins. The methylation pathway itself was also found to be self-regulated since ROS1 and ROS4, the main demethylating genes were found differentially methylated among the different genotypes. Even more, this work allowed us to detect genes regulated by methylation that were previously found differentially expressed in the comparisons between apomictic and sexual genotypes.</p>

opencc-by-4.0May 2021View details →
dryad36/100

Ecological divergence despite common mating sites: Genotypes and symbiotypes shed light on cryptic diversity in the black bean aphid species complex

<p>Different host plants represent ecologically dissimilar environments for phytophagous insects. The resulting divergent selection can promote the evolution of specialized host races, provided that gene flow is reduced between populations feeding on different plants. In black bean aphids belonging to the <em>Aphis fabae </em>complex, several morphologically cryptic taxa have been described based on their distinct host plant preferences. However, host choice and mate choice are largely decoupled in these insects: they are host-alternating and migrate between specific summer host plants and shared winter hosts, with mating occurring on the shared hosts. This provides a yearly opportunity for gene flow among aphids using different summer hosts, and raises the question if and to what extent the ecologically defined taxa are reproductively isolated. Here, we analyzed a geographically and temporally structured dataset of microsatellite genotypes from <em>A. fabae </em>that were mostly collected from their main winter host <em>Euonymus europaeus,</em> and additionally from another winter host and fourteen summer hosts. The data reveals multiple, strongly differentiated genetic clusters, which differ in their association with different summer and winter hosts. The clusters also differ in the frequency of infection with two heritable, facultative endosymbionts, separately hinting at reproductive isolation and divergent ecological selection. Furthermore, we found evidence for occasional hybridization among genetic clusters, with putative hybrids collected more frequently in spring than in autumn. This suggests that similar to host races in other phytophagous insects, both prezygotic and postzygotic barriers including selection against hybrids maintain genetic differentiation among <em>A. fabae </em>taxa, despite a common mating habitat.</p>

opencc-zeroApr 2024View details →
dryad36/100

Yield development and nutrient offtake in contrasting Miscanthus genotypes under green and brown harvest regimes

<p>Harvest time is an important variable that determines the yield of miscanthus biomass, its possible end uses, and the nutrient offtake from the field. Green harvests result in a higher yield and greater nutrient removal from the field. Brown miscanthus harvests, carried out in late winter or early spring, result in lower yields, and a lower nutrient offtake, whereby the harvested biomass is better suited to use in combustion. To look at the long term impact of green harvests on miscanthus this experiment followed the yield development of two miscanthus genotypes subjected to green and brown harvests over a period of seven years at one site in Southern Germany. The standard commercial genotype <em>Miscanthus x giganteus</em> (Mxg) was compared to a novel late-ripening <em>Miscanthus sinensis</em> genotype: Syn55.  Average yields of Mxg were 19.9 t ha<sup>-1</sup> for green harvests and 13.2 t ha<sup>-1</sup> for brown harvests compared to 13.9 t ha<sup>-1</sup> and 12.9 t ha<sup>-1</sup> for green and brown harvested Syn55 respectively. Yields of Mxg were very different for green and brown harvests; green harvested Mxg had very high nutrient offtake, while brown harvested Mxg had the lowest nutrient offtakes of all treatments. Syn55 showed a less marked difference between green and brown harvests likely due to its tendency to retain its leaves over winter. Syn55 was however not tolerant of a green harvest, with yields of brown harvested stands surpassing the yield of green harvested stands in several years. Mxg was shown to be tolerant of green harvests, producing consistently high yields when harvested in October. Early signs of yield decline were detected in both genotypes when harvested green, likely due to incomplete carbohydrate relocation. Alternating green and brown harvests are recommended to allow stands to replenish carbohydrate stores and to form a litter layer.  </p>

opencc-zeroApr 2024View details →
dryad36/100

Genotypes of Aedes aegypti mosquitoes derived from SNP chip and low-coverage whole genome sequencing for platform cross-validation

<p>The mosquito <em>Aedes aegypti </em>is the primary vector of many human arboviruses such as dengue, yellow fever, chikungunya, and Zika, which affect millions of people world-wide. Population genetics studies on this mosquito have been important in understanding its invasion pathways and success as a vector of human disease. The Axiom aegypti1 SNP chip was developed from a sample of geographically diverse <em>Ae. aegypti </em>populations to facilitate genomic studies on this species. Here we evaluate the utility of the Axiom aegypti1 SNP chip for population genetics and compare it with a low-depth shot-gun sequencing approach using mosquitoes from the species' native (Africa) and invasive range (outside Africa). These analyses indicate that the results from the SNP chip are highly reproducible and have a higher sensitivity to capture alternative alleles than a low-coverage whole-genome sequencing approach. Although the SNP chip suffers from ascertainment bias, results from population structure, ancestry, demographic, and phylogenetic analyses using the SNP chip were congruent with those derived from low coverage whole genome sequencing, and consistent with previous reports on Africa and outside Africa populations using microsatellites. More importantly, we identified a subset of SNPs that can be reliably used to generate merged databases, opening the door to combined analyses. We conclude that the Axiom aegypti1 SNP chip is a convenient, more accurate, low-cost alternative to low-depth whole genome sequencing for population genetic studies of <em>Ae. aegypti</em> that do not rely on full allelic frequency spectra. Whole genome sequencing and SNP chip data can be easily merged, extending the usefulness of both approaches. </p>

opencc-zeroApr 2024View details →
dryad36/100

Autosomal SNP-genotype data of brown bears (Ursus arctos) in Finland

<p>Harmonising methodology between countries is crucial in transborder population monitoring. However, immediate application of alleged, established DNA-based methods across the extended area can entail drawbacks and may lead to biases. Therefore, genetic methods need to be tested across the whole area before being deployed. Around 4,500 brown bears (<em>Ursus arctos</em>) live in Norway, Sweden, and Finland and they are divided into the western (Scandinavian) and eastern (Karelian) population. Both populations have recovered and are connected via asymmetric migration. DNA-based population monitoring in Norway and Sweden uses the same set of genetic markers. With Finland aiming to implement monitoring, we tested the available SNP-panel developed to assess brown bears in Norway and Sweden, on tissue samples from a representative set of 93 legally harvested individuals from Finland. The aim was to test for ascertainment bias and evaluate its suitability for DNA-based transnational-monitoring covering all three countries. We compared results to the performance of microsatellite genotypes of the same individuals in Finland and against SNP-genotypes from individuals sampled in Sweden (<em>N</em>=95) and Norway (<em>N</em>=27). In Finland, a higher resolution for individual identification was obtained for SNPs (PI=1.18E-27) compared to microsatellites (PI=4.2E-11). Compared to Norway and Sweden, probability of identity of the SNP-panel was slightly higher and expected heterozygosity lower in Finland indicating ascertainment bias. Yet, our evaluation show that the available SNP-panel outperforms the microsatellite panel currently applied in Norway and Sweden. The SNP-panel represents a powerful tool that could aid improving transnational DNA-based monitoring of brown bears across these three countries.</p>

opencc-zeroMay 2024View details →
dryad36/100

Code from: Early survival in Atlantic salmon is associated with parental genotypes at loci linked to timing of maturation

<p>Large effects loci often contain genes with critical developmental functions with potentially broad effects across life-stages. However, the life-stage-specific fitness consequences are rarely explored. In Atlantic salmon, variation in two large-effect loci, <em>six6</em> and <em>vgll3</em>, is linked to age at maturity, and several physiological and behavioural traits in early life. By genotyping the progeny of wild Atlantic salmon that were planted into natural streams with nutrient manipulations, we tested if genetic variation in these loci is associated with survival in early life. We found that higher early life survival was linked to the genotype associated with late maturation in the <em>vgll3</em>, but with early maturation in the <em>six6</em> locus. These effects were significant in high-nutrient, but not in in low-nutrient streams. The differences in early survival were not explained by additive genetic effects in the offspring generation, but by maternal genotypes in the <em>six6 </em>locus, and by both parents' genotypes in the <em>vgll3</em> locus. Our results suggest that indirect genetic effects by large-effect loci can be significant determinants of offspring fitness. This study demonstrates an intriguing case of how large-effect loci can exhibit complex fitness associations across life stages in the wild and indicates that predicting evolutionary dynamics is difficult.</p>

opencc-zeroMay 2024View details →
zenodo36/100

Continental-scale associations of Arabidopsis thaliana phyllosphere members with host genotype and drought

<p><strong><span>Plants are colonized by distinct pathogenic and commensal microbiomes across different regions of the globe, but the factors driving their geographic variation are largely unknown. Using 16S rDNA and shotgun sequencing, we characterized the associations of the <em>Arabidopsis thaliana</em> leaf microbiome with host genetics and climate variables from 267 populations in the species&rsquo; native range across Europe. Comparing the distribution of the 575 major bacterial amplicon variants (phylotypes), we discovered that microbiome composition in <em>A. thaliana</em> segregates along a latitudinal gradient. The latitudinal clines in microbiome composition are predicted by metrics of drought, but also by the spatial genetics of the host. To validate the relative effects of drought and host genotype we conducted a common garden field study, finding 10% of the core bacteria to be affected directly by drought, and 20% to be affected by host genetic associations with drought. These data provide a valuable resource for the plant microbiome field, with the identified associations suggesting that drought can directly and indirectly shape genetic variation in A. thaliana via the leaf microbiome.</span></strong></p>

opencc-by-4.0May 2024View details →
dryad36/100

Microsatellite genotypes of Cercidiphyllum japonicum seeds and identity numbers of the seed parents

<p>Genotypes at five microsatellite loci of 361 <em>Cercidiphyllum japonicum </em>seeds and identity numbers of their seed-parents in a population distributed over about 80 ha along a stream within Iwanazawa Forest Reserve (43°13′N, 142°34′E), University of Tokyo Hokkaido Forest, in central Hokkaido, Japan. Based on this and another data (<a href="https://doi.org/10.5061/dryad.zcrjdfnb7">https://doi.org/10.5061/dryad.zcrjdfnb7</a>), pattern of gene dispersal via pollen in this population was estimated by neighborhood model approach and Two generation analysis (TwoGener). These data set can be reused for review of the study and would be useful for comparison with other studies on gene dispersal of tree species.</p>

opencc-zeroMay 2024View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record