Find research datasets worth reusing

publicMay 2024View details →

Data from: Environmental DNA metabarcoding reveals temporal dynamics but functional stability of arthropod communities in cattle dung

Open the record for dataset details and reuse information.

publicAug 2020View details →

Data from: eDNA metabarcoding bioassessment of endangered fairy shrimp (Branchinecta spp.) - Part B

Open the record for dataset details and reuse information.

publicMay 2021View details →

Improving metabarcoding taxonomic assignment: A case study of fishes in a large marine ecosystem

Open the record for dataset details and reuse information.

publicAug 2020View details →

Data from: eDNA metabarcoding bioassessment of endangered fairy shrimp (Branchinecta spp.) - Part A

Open the record for dataset details and reuse information.

opencc-zeroJun 2020View details →

Data from: Metabarcoding on planktonic larval stages: an efficient approach for detecting and investigating life cycle dynamics of benthic aliens

High-throughput sequencing (HTS) technologies offer new promise to support surveillance programs targeting marine non-indigenous species (NIS). Metabarcoding might surpass traditional monitoring methods, for example through its ability to detect rare species, a key feature in early detection of NIS. Another interest of this approach is the identification of organisms difficult to identify based on morphology only (e.g., early developmental stages), making it relevant in the context of management programs. Because many marine benthic NIS have a bi-phasic bentho-pelagic life cycle, targeting their pelagic larval stages in zooplankton may allow early detection and assessment of their establishment and potential spread. We illustrate this approach with an analysis of bulk-DNA retrieved from a time-series of zooplankton samples collected over 22 months in one bay in Brittany (France). Using HTS of amplicons obtained with two markers (COI and 18S) and a metabarcoding approach, 12 NIS were identified and their temporal larval dynamics were monitored. Importantly, we chose to focus on a closed list of species, from four metazoan classes encompassing 52 NIS reported within the study area or nearby seas, with molecular references available or obtained locally for 42 of them. The use of a custom-designed database allowed the detection of three NIS otherwise not detected when using public databases. Interestingly, NIS known to have a short-lived larval stage were detected (e.g., the bryozoan Bugula neritina or the tunicate Corella eumyota). For two molluscs Ruditapes philippinarum and Crepidula fornicata, metabarcoding results were compared to those obtained using traditional methods (i.e., barcoding of individual larvae and morphology, respectively) to show the reliability of the approach in detecting and assessing the extent of their reproductive periods. Our results also revealed that the Pacific oyster Crassostrea gigas, a notorious invasive species, failed to reproduce in the study bay, showing that metabarcoding on larval stages also provides information regarding the establishment success (or failure) of NIS. While metabarcoding has its limitations and biases, this study demonstrates its effectiveness for surveillance of targeted NIS, notably to support management strategies like the European Marine Strategy Framework Directive (MSFD).

Data from: Capturing open ocean biodiversity: comparing environmental DNA metabarcoding to the continuous plankton recorder

Environmental DNA (eDNA) metabarcoding is emerging as a novel, objective tool for monitoring marine metazoan biodiversity. Zooplankton biodiversity in the vast and important open ocean is currently monitored through continuous plankton recorder (CPR) surveys, using ship-based bulk plankton sampling and morphological identification. We assessed whether eDNA metabarcoding (2 L filtered seawater) could capture similar Southern Ocean biodiversity as conventional CPR bulk sampling (~1500 L filtered seawater per CPR sample). We directly compared eDNA metabarcoding with (i) conventional morphological CPR sampling and (ii) bulk DNA metabarcoding of CPR collected plankton (two transects for each comparison, 40 and 44 paired samples respectively). A metazoan‐targeted cytochrome c oxidase I (COI) marker was used to characterize species-level diversity. In the 2 L eDNA samples this marker amplified large amounts of non‐metazoan picoplanktonic algae, but eDNA metabarcoding still detected up to 1.6 times more zooplankton species than morphologically analysed bulk CPR samples. COI metabarcoding of bulk DNA samples mostly avoided non-metazoan amplifications and recovered more zooplankton species than eDNA metabarcoding. However, eDNA metabarcoding detected roughly two thirds of metazoan species and identified similar taxa contributing to community differentiation across the subtropical front separating transects. We observed a diurnal pattern in eDNA data for copepods which perform diel vertical migrations, indicating a surprisingly short temporal eDNA signal. Compared to COI, a eukaryote-targeted 18S ribosomal RNA marker detected a higher proportion, but lower diversity, of metazoans in eDNA. With refinement and standardization of methodology, eDNA metabarcoding could become an efficient tool for monitoring open ocean biodiversity.

Supplementary material 6 from: Zizka VMA, Weiss M, Leese F (2020) Can metabarcoding resolve intraspecific genetic diversity changes to environmental stressors? A test case using river macrozoobenthos. Metabarcoding and Metagenomics 4: e51925. https://doi.org/10.3897/mbmg.4.51925

Figure S6. Average nucleotide diversity for all four datasets of shared OTUs seperated according to sample sites and EPT (Ephemeroptera, Plecoptera, Trichoptera) and PR ('Pollution Resistant') taxa

Supplementary material 5 from: Zizka VMA, Weiss M, Leese F (2020) Can metabarcoding resolve intraspecific genetic diversity changes to environmental stressors? A test case using river macrozoobenthos. Metabarcoding and Metagenomics 4: e51925. https://doi.org/10.3897/mbmg.4.51925

Figure S5. Average haplotype diversity for all four datasets of shared OTUs seperated according to sample sites and EPT (Ephemeroptera, Plecoptera, Trichoptera) and PR ('Pollution Resistant') taxa

Supplementary material 7 from: Zizka VMA, Weiss M, Leese F (2020) Can metabarcoding resolve intraspecific genetic diversity changes to environmental stressors? A test case using river macrozoobenthos. Metabarcoding and Metagenomics 4: e51925. https://doi.org/10.3897/mbmg.4.51925

Figure S7 – part 1. Haplotype network of the two most frequent EPT (Ephemeroptera, Plecoptera, Trichoptera) and PR ('Pollution Resistant') taxa

Supplementary material 4 from: Zizka VMA, Weiss M, Leese F (2020) Can metabarcoding resolve intraspecific genetic diversity changes to environmental stressors? A test case using river macrozoobenthos. Metabarcoding and Metagenomics 4: e51925. https://doi.org/10.3897/mbmg.4.51925

Figure S4. Average haplotype number per OTU for the four different datasets of shared OTUs. Datasets are split into EPT (Ephemeroptera, Plecoptera, Trichoptera) and PR ('Pollution Resistant') taxa

Supplementary material 3 from: Zizka VMA, Weiss M, Leese F (2020) Can metabarcoding resolve intraspecific genetic diversity changes to environmental stressors? A test case using river macrozoobenthos. Metabarcoding and Metagenomics 4: e51925. https://doi.org/10.3897/mbmg.4.51925

Figure S3. Average haplotype number per OTU for the four different datasets of shared OTUs. Values are illustrated for all sample sites including all shared OTUs

Supplementary material 2 from: Zizka VMA, Weiss M, Leese F (2020) Can metabarcoding resolve intraspecific genetic diversity changes to environmental stressors? A test case using river macrozoobenthos. Metabarcoding and Metagenomics 4: e51925. https://doi.org/10.3897/mbmg.4.51925

Figure S2. Four different datasets including shared OTUs between the different river systems (Emscher-Ennepe-Sieg, Emscher-Ennepe, Emscher-Sieg, Sieg-Ennepe). Number of OTUs is illustrated with taxonomic assignment on order level

Supplementary material 1 from: Zizka VMA, Weiss M, Leese F (2020) Can metabarcoding resolve intraspecific genetic diversity changes to environmental stressors? A test case using river macrozoobenthos. Metabarcoding and Metagenomics 4: e51925. https://doi.org/10.3897/mbmg.4.51925

Figure S1. Total number of aquatic macroinvertebrate individuals per sample and season plotted against the average haplotype number per OTU. Different colours indicate the three river systems

Tagsteady: a metabarcoding library preparation protocol to avoid false assignment of sequences to samples

Metabarcoding of environmental DNA (eDNA) and DNA extracted from bulk specimen samples is a powerful tool in studies of biodiversity, diet and ecological interactions as its inherent labelling of amplicons allows sequencing of taxonomically informative genetic markers from many samples in parallel. However, the occurrence of so-called 'tag-jumps' can cause incorrect assignment of sequences to samples and artificially inflate diversity. Two steps during library preparation of pools of 5' nucleotide-tagged amplicons have been suggested to cause tag-jumps; i) T4 DNA polymerase blunt-ending in the end-repair step and ii) post-ligation PCR amplification of amplicon libraries. The discovery of tag-jumps has led to recommendations to only carry out metabarcoding PCR amplifications with primers carrying twin-tags to ensure that tag-jumps cannot result in false assignments of sequences to samples. As this increases both cost and workload, a metabarcoding library preparation protocol which circumvents the two steps that causes tag-jumps is needed. Here, we demonstrate Tagsteady, a metabarcoding Illumina library preparation protocol for pools of nucleotide-tagged amplicons that enables efficient and cost-effective generation of metabarcoding data with virtually no tag-jumps. We use pools of twin-tagged amplicons to investigate the effect of T4 DNA polymerase blunt-ending and post-ligation PCR on the occurrence of tag-jumps. We demonstrate that both blunt-ending and post-ligation PCR, alone or together, can result in detrimental amounts of tag-jumps (here, up to ca. 49% of total sequences), while leaving both steps out (the Tagsteady protocol) results in amounts of sequences carrying new combinations of used tags (tag-jumps) comparable to background contamination.

Under the karst: detecting hidden subterranean assemblages using eDNA metabarcoding in the caves of Christmas Island, Australia

Subterranean ecosystems are understudied and challenging to conventionally survey given the inaccessibility of underground voids and networks. In this study, we conducted a eukaryotic environmental (eDNA) metabarcoding survey across the karst landscape of Christmas Island, (Indian Ocean, Australia) to evaluate the utility of this non-invasive technique to detect subterranean aquatic 'stygofauna' assemblages. Three metabarcoding assays targeting the mitochondrial 16S rRNA and nuclear 18S genes were applied to 159 water and sediment samples collected from 23 caves and springs across the island. Taken together, our assays detected a wide diversity of chordates, cnidarians, porifera, arthropods, molluscs, annelids and bryozoans from 71 families across 60 orders. We report a high level of variation between cave and spring subterranean community compositions which are significantly influenced by varying levels of salinity. Additionally, we show that dissolved oxygen and longitudinal gradients significantly affect biotic assemblages within cave communities. Lastly, we combined eDNA-derived community composition and environmental (water quality) data to predict potential underground interconnectivity across Christmas Island. We identified three cave and spring groups that showed a high degree of biotic and abiotic similarity indicating likely local connectivity. This study demonstrates the applicability of eDNA metabarcoding to detect subterranean eukaryotic communities and explore underground interconnectivity.

Advances in metabarcoding techniques bring us closer to reliable monitoring of the marine benthos

1. Reliable and accurate biodiversity census methods are essential for monitoring ecosystem health and assessing potential ecological impacts of future development projects. Although metabarcoding is increasingly used to study biodiversity across ecological research, morphology-based identification remains the preferred approach for marine ecological impact assessments. Comparing metabarcoding to morphology-based protocols currently used by ecological surveyors is essential to determine whether this DNA-based approach is suitable for the long-term monitoring of marine ecosystems. 2. We compared metabarcoding and morphology-based approaches for the analysis of invertebrates in low diversity intertidal marine sediment samples. We used a recently developed bioinformatics pipeline and two taxonomic assignment methods to resolve and assign amplicon sequence variants (ASVs) from Illumina amplicon data. We analysed the community composition recovered by both methods and tested the effects, on the levels of diversity detected by the metabarcoding method, of sieving samples prior to DNA extraction. 3. Metabarcoding of the mitochondrial marker cytochrome c oxidase I (COI) gene recovers the presence of more taxonomic groups than the morphological approach. We found that sieving samples results in lower alpha diversity detected and suggests a community composition that differs significantly from that suggested by un-sieved samples in our metabarcoding analysis. We found that whilst metabarcoding and morphological approaches detected similar numbers of species, they are unable to identify the same set of species across samples. 4. Synthesis and Applications We show that metabarcoding using the COI marker provides a more holistic, community-based, analysis of benthic invertebrate diversity than a traditional morphological approach. We also highlight current gaps in reference databases and bioinformatic pipelines for the identification of intertidal benthic invertebrates that need to be addressed before metabarcoding can replace traditional methods. Ultimately, with these limitations taken into consideration, resolving community-wide diversity patterns with metabarcoding could improve the management of non-protected marine habitats in the U.K.14-Jul-2020

Diatom sedimentary ancient DNA metabarcoding from western Fram Strait and Kronotsky Peninsula

In this study we use sedimentary ancient DNA metabarcoding from two marine sediment cores. The first Kastenlot core MSM05/5-712-2 was taken at western Fram Strait (subarctic North Atlantic) from which we collected 12 samples including one biological replicate. The second Kastenlot core SO201-2-12KL was retrieved from Kamchatka Strait (subarctic North Pacific) from which we collected 9 samples and 2 samples were collected from a pilot core taken next to the Kastenlot core. Total DNA was extracted from approximately 2ml sediment per sample in 3 batches with up to 9 samples and one extraction blank. Total DNA was concentrated and if necessary diluted to 2.5 ng/µl. For each batch we performed PCRs in triplicates including a PCR no template control (NTC). We amplified a diatom-specific, 76 bp long part of the rbcL gene with tagged primers Diat_rbcL_705F (AACAGGTGAAGTTAAAGGTTCATAYTT) and Diat_rbcL_808R (TGTAACCCATAACTAAATCGATCAT). The PCR-products were purified and pooled in equal concentrations. The sequencing library was prepared with the Mid Output kit v. 2 according to the Fasteris Metafast protocol for low complexity amplicon sequencing and checked by qPCR. The library was sequenced (2 x 150 bp, paired-end) on the Illumina NextSeq 500 at the Fasteris SA sequencing service (Switzerland). For two samples we sequenced 4 PCR-products and for two samples we could only get 2 PCR-products with sufficient DNA content for sequencing.

Marine biomonitoring with eDNA: can metabarcoding of water samples cut it as a tool for surveying benthic communities?

In the marine realm, biomonitoring using eDNA of benthic communities requires destructive direct sampling or the setting-up of settlement structures. Comparatively much less effort is required to sample the water column, which can be accessed remotely. In this study we assess the feasibility of obtaining information from the eukaryotic benthic communities by sampling the adjacent water layer. We studied two different rocky-substrate benthic communities with a technique based on quadrat sampling. We also took replicate water samples at distances from a few centimetres to 20 m from the benthic habitat. Using as marker a fragment of the Cytochrome c oxidase subunit I gene with universal primers, we obtained a total of 3,543 molecular operational taxonomic units (MOTUs) from the samples. The structure obtained in the two environments was markedly different, with Metazoa, Archaeplastida Rhodophyta and Stramenopiles being the most diverse group in benthic samples, and HacrobiaAlveolata, Metazoa and Alveolata Rhizaria in the water. Only 265 MOTUs (7.5%) were shared between benthos and water samples, and of these 180 MOTUs (5.1%) were identified as benthic MOTUs that left their DNA in the water. Most of them were found immediately adjacent to the benthos, and their number decreased and The distribution of these benthic shared MOTUs showed a decrease both in number of MOTUs and in number of reads as we moved apart from the benthic habitat. It was concluded that water eDNA, even in the close vicinity of the benthos, was a poor proxy for the analysis of benthic structure, and that direct sampling methods are required for monitoring these complex benthic communities via metabarcoding.

opencc-zeroFeb 2021View details →

Efficacy of metabarcoding for identification of fish eggs evaluated with mock communities

There is urgent need for effective and efficient monitoring of marine fish populations. Monitoring eggs and larval fish may be more informative that traditional fish surveys since ichthyoplankton surveys reveal the reproductive activities of fish populations, which directly impact their population trajectories. Ichthyoplankton surveys have turned to molecular methods (DNA barcoding & metabarcoding) for identification of eggs and larval fish due to challenges of morphological identification. In this study we examine the effectiveness of using metabarcoding methods on mock communities of known fish egg DNA. We constructed six mock communities with known ratios of species. In addition we analyzed two samples from a large field collection of fish eggs and compared metabarcoding results with traditional DNA barcoding results. We examine the ability of our metabarcoding methods to detect species and relative proportion of species identified in each mock community. We found that our metabarcoding methods were able to detect species at very low input proportions, however levels of successful detection depended on the markers used in amplification, suggesting that the use of multiple markers is desirable. Variability in our quantitative results may result from amplification bias as well as interspecific variation in mitochondrial DNA copy number. Our results demonstrate that there remain significant challenges to using metabarcoding for estimating proportional species composition; however the results provide important insights into understanding how to interpret metabarcoding data. This study will aid in the continuing development of efficient molecular methods of biological monitoring for fisheries management.