Find research datasets worth reusing

opencc-by-4.0Jul 2022View details →

Figures 1–9 in Whiteflies (Hemiptera: Aleyrodidae) intercepted on plant product imported to South Korea from 2013-2021

Figures 1–9. Seven species of whiteflies. 1–2) Aleurocanthus rugosa Singh, puparium and spines with fimbriate apices. 3) Aleurocanthus spiniferus (Quaintance), puparium. 4–5) Aleurocanthus woglumi Ashby, puparium and thoracic margin. 6) Aleuroclava aucubae (Kuwana), puparium. 7) Aleuroclava euryae (Kuwana), puparium. 8) Aleuroclava gordoniae (Takahashi), puparium. 9) Aleuroclava hikosanensis (Takahashi), puparium.

opencc-by-4.0Jul 2022View details →

Figures 28–36 in Whiteflies (Hemiptera: Aleyrodidae) intercepted on plant product imported to South Korea from 2013-2021

Figures 28–36. Nine species of whiteflies. 28) Orchamoplatus mammaeferus (Quaintance and Baker), puparium. 29) Parabemisia myricae (Kuwana), puparium. 30) Pealius mori (Takahashi), puparium. 31) Singhiella simplex (Singh), puparium. 32) Tetraleurodes sp., puparium. 33) Tetraleurodes ursorum (Cockerell), puparium. 34) Trialeurodes glacialis (Bemis), puparium. 35) Trialeurodes vaporariorum (Westwood), puparium. 36) Tuberaleyrodes sp., puparium.

opencc-by-4.0Oct 2021View details →

Plant Communities at the Eden Project, UK, derived from soil eDNA

The project seeks to understand the potential for the use of eDNA collected from soil to characterise plant communities. To do so, soils were sampled at the Eden Project in Cornwall UK, within the two covered biomes where we have a good understanding of the structure and composition of plant communities (further quantified with above ground plant coverage inventories). 32 plots were established across 10 different plant assemblages, each of which experiences subtle differences in soil chemistry and microclimate. Each plot consists of a 2 x 2 m quadrat, with four soil aggregates collected at each corner.  eDNA was then extracted and amplified following the methods detailed in Zinger et al. (2016) and Donald et al. (2021). The primers used targeted the P6 loop of thechloroplastic  trnL intron [primer_fwd: GGGCAATCCTGAGCCAA, primer_rev: CCATTGAGTCTCTGCACCTATC] (Taberlet et al. 2007). 16 Extraction, 54 Sequencing, and 16 PCR controls are included so as to account for potential errors generated during the processing of samples, with a mock community (4 positive controls) of 10 known plant sequences also included to guide filtering thresholds. PCR products were pooled and sequencing libraries were constructed using the Illumina TruSeq NanoPCRFree kit following the supplier’s instructions (Illumina Inc., San Diego, California, USA), except that the ligation product was not PCR amplified to limit tag-jump biases (Taberlet et al 2018). The libraries were then sequenced on an Illumina Hiseq platform (San Diego, CA, USA). Sequencing was conducted by the GenoToul bioinformatics platform (Toulouse, France), with the OBITOOLS package (Boyer et al. 2016). Here, the produced sequence data was processed using the following steps. First, ‘illuminapairedend’ was used to assemble paired-end reads. This algorithm is based on an exact alignment algorithm that considers the quality scores at all positions during the assembly process. Subsequently, we used the ‘ngsfilter’ command to identify and remove the primers and tags on each read, and assign reads to their respective samples (NGS filter file provided: ngsfilter_TRNL_PLANTS_EDEN_PROJECTb.txt). This program was used with its default parameters tolerating two mismatches for each of the two primers and no mismatch for the tags. Following this, sequencing reads were dereplicated using the ‘obiuniq’ command. The produced data.uniq.fasta file is supplied here. Sequences were then further filtered to remove sequences of low quality (containing Ns or with paired-end alignment scores below 50), and sequences represented by only one read (singletons) using the ‘obigrep’ command. To remove PCR/sequencing errors as well as intraspecific variability, we built OTUs (Operational Taxonomic Units) using the ‘sumaclust’ clustering algorithm (Mercier et al. 2013), which considers the most abundant sequence of each cluster as the cluster representative.  OTUs were set at a sequence similarity threshold of 95%. To assign a taxon to plant OTUs, we built a reference sequence database using the ecoPCR programme (Ficetola et al. 2010) on the European Molecular Biology Laboratory (EMBL; release 141). OTUs were then assigned a taxonomy, using OBITOOL’s ecotag programme (Boyer et al. 2016), which performs a global alignment of each OTU sequence (the query) against each reference. The reference taxon assigned to each OTU corresponds to the Last Common Ancestor of all the best-match sequences for the query.  Datasets were subsequently filtered to remove contaminants as well as artefacts such as PCR chimeras and remaining sequencing errors, using routines implemented in the metabaR R package (Zinger et al 2021), in R version 3.6.1 (R Development Core Team, 2013). The filtering process consisted of four steps: (i) a negative control-based filtering. OTUs whose maximum abundance was found in extraction/PCR negative controls were removed from the dataset, as they were likely to be reagent/aerosol contaminants, better amplified in the absence of competing DNA fragments as it is the case in biological samples. (ii) a reference-based filtering. OTUs which are too dissimilar from sequences available in reference databases are potential chimeras generated during sequencing and amplification. In this study, we chose to set similarity thresholds at 100%. (iii) an abundance-based filtering. This procedure targets incorrect assignment of a few numbers of sequences corresponding to true OTUs occurring to the wrong sample, a phenomenon called “tag-switching”. It consists in setting OTUs abundances to 0 in samples where their abundance represents < 0.03% of the total OTU abundance in the entire dataset. (iv) Finally, we conducted a PCR-based filtering by considering any PCR reaction that yielded less than 1000 reads as non-functional, and removed them from the dataset. The script used for implementing this is provided (metabaR_Eden_Plants_100sim.html), with sequence data processed to remove contaminants, OTUs of low taxonomic resolution, and PCRs with too low a read count. The clean data is provided (eden_plant_postclean_100sim.rds). References: Boyer, F. et al. (2016) ‘obitools: a unix-inspired software package for DNA metabarcoding’, Molecular Ecology Resources, 16(1), pp. 176–182. doi:<a href="https://doi.org/10.1111/1755-0998.12428">10.1111/1755-0998.12428</a>. Donald, J. et al. (2021) '‘Multi-taxa environmental DNA inventories reveal distinct taxonomic and functional diversity in urban tropical forest fragments.‘ Global Ecology and Conservation 29 (2021): e01724. Mercier, C. et al. (2013) ‘SUMATRA and SUMACLUST: fast and exact comparison and clustering of sequences’, in Programs and Abstracts of the SeqBio 2013 workshop. Abstract. Citeseer, pp. 27–29. Taberlet, P. et al. (2007) ‘Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding’, Nucleic Acids Research, 35(3), pp. e14–e14. doi:<a href="https://doi.org/10.1093/nar/gkl938">10.1093/nar/gkl938</a>. Taberlet, P. et al. (2018) Environmental DNA: For Biodiversity Research and Monitoring. Oxford University Press. Team, R.C. (2013) R: A language and environment for statistical computing. Vienna, Austria. Zinger, L. et al. (2016) ‘Extracellular DNA extraction is a fast, cheap and reliable alternative for multi-taxa surveys based on soil DNA’, Soil Biology and Biochemistry, 96, pp. 16–19. Zinger, L. et al. (2021) ‘metabaR: An r package for the evaluation and improvement of DNA metabarcoding data quality’, Methods in Ecology and Evolution. DOI: <a href="https://doi.org/10.1111/2041-210X.13552">https://doi.org/10.1111/2041-210X.13552</a>

opencc-by-4.0Nov 2022View details →

Scolytinae Xyleborini host plants dataset

The present database includes all Xyleborini species known and described prior to October 30th 2022 and their relative host plants.

opencc-by-4.0Feb 2024View details →

Insecticide resistance triggers a reduction of virulence to host-plant defenses in the brown planthopper

This dataset contains R scripts to analyze the virulence of resistance rice cultivars and to draw figures. Data contains the LD50 values of imidacloprid, virulence test and figure data. This study was supported by grants-in-aid from Japan's National Agriculture and Food Research Organization (NARO) project 315 and the NARO Innovation Project 2017 for the NARO.

FIG. 7 in New data on the Permian ecosystem of the Rodez Basin: ichnofauna (traces of protostomians, tetrapods and fishes), jellyfishes and plants from Banassac-Canilhac (Lozère, southern France)

FIG. 7. — Slab showing the co-occurrence of tetrapod swimming tracks (Characichnos isp.) and fish trails (Undichna cf. britannica Higgs, 1988): A, photograph; B, interpretative sketch showing tetrapod swimming tracks (in red) and fish trails (in black); C, interpretative sketch showing only tetrapod swimming tracks; D, interpretative sketch showing only fish trails; E-G, details of fish trails. M486_2022.1.8. Scale bars: 2 cm.

FIG. 3 in New data on the Permian ecosystem of the Rodez Basin: ichnofauna (traces of protostomians, tetrapods and fishes), jellyfishes and plants from Banassac-Canilhac (Lozère, southern France)

FIG. 3. — Jellyfish and protostomian traces: A, B, Medusina atava (Pohlig, 1892) Walcott,1898,photograph (A) and interpretative sketch (B), specimen M486_2022.1.9; C, D, Diplopodichnus biformis Brady, 1947 (Di.) and Scoyenia gracilis White, 1929 (Sc.); photograph (C) and interpretative sketch, specimen M486_2022.1.2. Abbreviations: Ma., manubrium; Ra., radial canals; Ve., velum. Scale bars: 1 cm.

FIG. 2 in New data on the Permian ecosystem of the Rodez Basin: ichnofauna (traces of protostomians, tetrapods and fishes), jellyfishes and plants from Banassac-Canilhac (Lozère, southern France)

FIG. 2. — Stratigraphic section of Le Bousquet and location of the fossiliferous bed. Abbreviations: Thi., thickness; Lith., lithology.

FIG. 6 in New data on the Permian ecosystem of the Rodez Basin: ichnofauna (traces of protostomians, tetrapods and fishes), jellyfishes and plants from Banassac-Canilhac (Lozère, southern France)

FIG. 6. — Ichniotherium isp.: A, B, pes/manus set, photograph (A) and interpretative sketch (B). Convex hyporeliefs, M486_2022.1.4B. Abbreviations: p., pes track; m., manus track. Scale bars: 1 cm.

FIG. 5 in New data on the Permian ecosystem of the Rodez Basin: ichnofauna (traces of protostomians, tetrapods and fishes), jellyfishes and plants from Banassac-Canilhac (Lozère, southern France)

FIG. 5. — Batrachichnus salamandroides Geinitz, 1861: A, B, slab bearing a trackway with pes (p.) and manus (m.) track (a pes/manus set in visible in the bottom part of the picture), and co-occurring with a conifer leafy axis (c) (cf. Walchia, in the top of the picture), photograph (A) and interpretative sketch (B); C-E, pes track, photograph (C), digital elevation model in false colours (D) and interpretative sketch (E). Convex hyporeliefs, M486_2022.1.6B. Scale bars: 1 cm.

FIG. 1 in New data on the Permian ecosystem of the Rodez Basin: ichnofauna (traces of protostomians, tetrapods and fishes), jellyfishes and plants from Banassac-Canilhac (Lozère, southern France)

FIG. 1. — Geographical and geological context: A, Location of the study area in France; B, Location of the Rodez Basin, and location of La Canourgue/Campagnac area (indicated by the black rectangle); C, Simplified geological map of La Canourgue/Campagnac area (modified after Defaut et al. 1990) and location of tracksites mentionned in Gand (1987): 1, La Forêt; 2, Cantacoyou; 3, Le Bousquet; 4, Route du Viaduc; 5, Malvezy; 6, Saint-Laurent.

Body size as a magic trait in two plant-feeding insect species

When gene flow accompanies speciation, recombination can decouple divergently selected loci and loci conferring reproductive isolation. This barrier to sympatric divergence disappears when assortative mating and disruptive selection involve the same "magic" trait. Although magic traits could be widespread, the relative importance of different types of magic traits to speciation remains unclear. Because body size frequently contributes to host adaptation and assortative mating in plant-feeding insects, we evaluated several magic trait predictions for this trait in a pair of sympatric Neodiprion sawfly species adapted to different pine hosts. A large morphological dataset revealed that sawfly adults from populations and species that use thicker-needled pines are consistently larger than those that use thinner-needled pines. Fitness data from recombinant backcross females revealed that egg size is under divergent selection between the preferred pines. Lastly, mating assays revealed strong size-assortative mating within and between species in three different crosses, with the strongest prezygotic isolation between populations that have the greatest interspecific size differences. Together, our data support body size as a magic trait in pine sawflies and possibly many other plant-feeding insects. Our work also demonstrates how intraspecific variation in morphology and ecology can cause geographic variation in the strength of prezygotic isolation.

Contrasting effects of two phenotypes of an alpine cushion plant on understory species drive community assembly

In alpine systems, cushion plants act as foundation species by ameliorating local environmental conditions. Empirical studies indicate that contrasting phenotypes of alpine cushion species have different effects on understory plant species, either facilitative or competitive. Furthermore, dependent species within each community type might also exhibit different responses to each cushion phenotype, which can be clustered into several "response groups". Additionally, these species-groups specific responses to alpine cushion species phenotypes could alter community assembly. However, very few studies have assessed responses of dependent communities at species-group levels, in particular for both above- and below-ground communities. Here, we selected a loose and a tight phenotype of the alpine cushion species Thylacospermum caespitosum in two sites in northwest China, and use the relative intensity of interactions index to quantify cushion plant effects on subordinate communities of plants and soil fungi and bacteria. We assessed variations in responses of both above- and below-ground organisms to cushion plant effects at species-group level. Species-group level analyses showed that the effects of the phenotype varied among groups of each of the three community types, and different species-groups were composed of unique taxa. Additionally, we found that loose cushions enhanced stochastic processes in community assembly, for plants and soil fungi but not for soil bacteria. These variations of phenotypic effects on different species-group induced contrasting taxonomic composition between groups and altered community assembly thereby. Our study highlights the occurrence of contrasting effects of two phenotypes of a foundation cushion plant on understory plants, soil fungi and bacteria community composition, but not necessarily on their richness. We also showed that assessing responses of understory species at the species-group level allows a more realistic and mechanistic understanding of biotic interactions both for above- and below-ground communities.

Data from: Invasive plants have greater growth than co-occurring natives in live soil subjected to a drought-rewetting treatment

Although several studies indicate that invasive plant species respond more negatively to drought than native plant species, little remains understood of how and whether drought-rewetting events may affect growth of invasive and co-occurring native plant species both directly and indirectly through soil microorganisms. In a fully crossed factorial design, we grew individuals of four congeneric pairs of invasive and native plant species in 2.5 L pots that contained live or sterilized field soil under one of three drought treatments: no-drought, drought, drought-rewetting. Results show that drought caused a significantly greater decline in total biomass of invasive plants than that of native plants regardless of the presence of live soil microorganisms. However, total biomass of the invasive plants exhibited a greater recovery from drought following rewetting than did that of the native plant species. Moreover, the recovery from drought in invasive species tended to be stronger in live soil than in sterilized soil, while for the native plants, recovery from drought was stronger in sterilized soil than in live soil. Overall, these results suggest that soil biota may enable invasive plants to grow larger than co-occurring native plant species in ecosystems that experience cycles of drought and rewetting.

Data for: Effects of parental age on salt stress tolerance in an aquatic plant

Parental age influences components of offspring fitness in many species. The ability to tolerate stress also affects fitness, but less is known regarding changes in offspring stress tolerance with increasing parental age, especially in plants. We examined first and fifth-born clonal offspring (using birth order as a proxy for parental age), and compared their fitness in several sub-lethal concentrations of salt (NaCl), to investigate the interactive effects of birth order and salt stress on the offspring of the aquatic plant Lemna minor L. We found that increasing salt concentration reduced reproduction particularly at early ages, which detrimentally affected fitness, as measured by the intrinsic rate of natural increase. Fifth offspring had greater fitness than first offspring, potentially due to the hump-shaped relationship between offspring fitness and birth order observed in other studies on Lemna, with fifth offspring near the peak of the hump. We found no interactive effect of birth order and salt concentration on offspring fitness; however, there were interactive effects on the time to first reproduction and the size of fronds. Specifically, first offspring exposed to increasing salt concentrations exhibited longer delays to first reproduction and grew to a greater size, while fifth offspring showed little change in either variable with increasing salt concentration. Thus, variation in birth order affected offspring response to salt stress, although not in terms of fitness. These results help illuminate factors impacting the age-specific strength of natural selection and stress responses, and may be environmentally relevant in the context of environmental salinization.

The diversity and distribution of introduced plant species reflects eight thousand years of settlement history

Human population has affected natural ecosystems since prehistoric times in many ways, causing disturbances in existing ecosystems and creating novel habitats, and altering the colonisation and extinction rates with potentially long-lasting effects on biodiversity. Here, we explored the pervasive effects of past human occupancy on present-day diversity and the distribution of plant species introduced by humans in the distant past – archaeophytes – at the regional spatial scale. We analysed spatial relations between the present-day species richness of archaeophytes and native flora, the environmental setting, archaeological evidence, and the relationship between the residence time of archaeophytes and their regional range size. We used fine-scaled gridded information on plant diversity and archaeological records for the period 6000 BCE to 1000 CE summarised as average occupancy probability (AOP) in Czechia, Central Europe. The proportion of archaeophytes in local flora positively correlated to AOP. Variation partitioning revealed largely overlapping effects of AOP, environmental conditions, and present-day land use on the relative diversity of archaeophytes in local flora. The relationship between the minimum residence time of introduced species and their regional range size was weak and non-significant. Synthesis. Our results suggest that the present-day regional diversity of archaeophytes mirrors the intensity of past human settlement. However, the main underlying mechanism is the dispersal and environmental filtering of non-native species pools, while dispersal limitation plays a minor role in the regional patterns of archaeophyte diversity.

opencc-by-4.0Dec 2022View details →

Short-term effects of the control of an invasive plant Asclepias syriaca: secondary invasion of other neophytes instead of the recovery of native species

Data sets to article: "Short-term effects of the control of an invasive plant Asclepias syriaca: secondary invasion of other neophytes instead of the recovery of native species". We studied the impact of Asclepias syriaca, a non-native herb species, on basic soil attributes and vegetation composition in sandy grasslands and the effect of mechanical control of this species.  The Asclepias invasion changed the vegetation composition, but not the studied soil attributes. The shot-term cutting suppressed Asclepias, but instead of the recovery of native species, secondary invasion by other alien species occurred.

opencc-by-4.0Dec 2021View details →

[Data from:] Hypersensitive-like response in Brassica plants is specifically induced by molecules from egg-associated secretions of cabbage white butterflies

Characterization at physiological and molecular level of a HR-like cell death induced by Pieris spp. butterfly eggs in Brassica plants.

opencc-by-4.0Oct 2022View details →

Figure 2 in Silicon derivatives induced host plant resistance against Tetranychus urticae (Acari: Tetranychidae) in eggplants farms

Figure 2. (A) Silicon leaf, total protein and phenol contents, (B) Activity of POD, CAT, and PPO of S. melongena- treated plants. Means followed by the same letter are not significantly different using Tukey's HSD Test at P <0.05. T1 = Control, T2 = OSAB 2 mL L−1, T3= OSAB 4 mL L−1, T4= Silica K 2 mL L−1, and T5 = Silica K 4 mL L−1.