Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
762
datasets available to search
ShareScore release 0.9.0
Dataset results
762 results for “Spider phylogeny”
Supplementary material 1 from: Maddison WP, Evans SC, Hamilton CA, Bond JE, Lemmon AR, Lemmon EM (2017) A genome-wide phylogeny of jumping spiders (Araneae, Salticidae), using anchored hybrid enrichment. ZooKeys 695: 89-101. https://doi.org/10.3897/zookeys.695.13852
Supplementary table of assembly statistics : Explanation note: Statistics describing raw reads, loci, sequence lengths, and other aspects of sequencing assembly for each of the 34 salticid taxa and 12 outgroup taxa.
Supplementary material 1 from: Borkent CJ, Gillung JP, Winterton SL (2016) Jewelled spider flies of North America: a revision and phylogeny of Eulonchus Gerstaecker (Diptera, Acroceridae). ZooKeys 619: 103-146. https://doi.org/10.3897/zookeys.619.8249
Table 3 : Explanation note: Non-type material examined (EIS # = Evert I. Schlinger collection database specimen accession number). See Materials and methods section for notes on depositories.
Supplementary material 1 from: Maddison W, Li D, Bodner M, Zhang J, Xin X, Liu Q, Liu F (2014) The deep phylogeny of jumping spiders (Araneae, Salticidae). ZooKeys 440: 57-87. https://doi.org/10.3897/zookeys.440.7891
Specimens used in phylogenetic analyses, with localities and GenBank numbers of sequences indicated.:
Supplementary material 4 from: Huber BA, Eberle J, Dimitrov D (2018) The phylogeny of pholcid spiders: a critical evaluation of relationships suggested by molecular data (Araneae, Pholcidae). ZooKeys 789: 51-101. https://doi.org/10.3897/zookeys.789.22781
Figure S4. Maximum-likelihood tree (RAxML) of a reduced set of taxa (excluding taxa for which less than four genes were available) : Explanation note: In the text we refer to this tree as '4+ genes tree'. Support values as in Figure S1.
Supplementary material 3 from: Huber BA, Eberle J, Dimitrov D (2018) The phylogeny of pholcid spiders: a critical evaluation of relationships suggested by molecular data (Araneae, Pholcidae). ZooKeys 789: 51-101. https://doi.org/10.3897/zookeys.789.22781
Figure S3. Maximum-likelihood tree (RAxML) of a reduced set of taxa (excluding rogue taxa with RogueNaRok) : Explanation note: In the text we refer to this tree as 'RogueNaRok tree'. Support values: RBS.
Supplementary material 2 from: Huber BA, Eberle J, Dimitrov D (2018) The phylogeny of pholcid spiders: a critical evaluation of relationships suggested by molecular data (Araneae, Pholcidae). ZooKeys 789: 51-101. https://doi.org/10.3897/zookeys.789.22781
Figure S2. Maximum-likelihood tree of the complete set of taxa inferred with RAxML : Explanation note: Support values as in Figure S1.
Supplementary material 1 from: Huber BA, Eberle J, Dimitrov D (2018) The phylogeny of pholcid spiders: a critical evaluation of relationships suggested by molecular data (Araneae, Pholcidae). ZooKeys 789: 51-101. https://doi.org/10.3897/zookeys.789.22781
Figure S1. Maximum-likelihood tree of the complete set of taxa inferred with IQ-TREE : Explanation note: This tree is identical to the one shown in Figs 2–12 except that it includes all outgroups and all support values are shown (in the sequence SBS / RBS / SH-like aLRT).
Fig. 3 in A molecular phylogeny of nephilid spiders: Evolutionary history of a model lineage
Fig. 3. Tree shapes for seven genes obtained with ML (best tree out of 100 replicates) with ingroup in green and outgroups in red. Note that for the two nuclear ribosomal genes (18S and 28S) the ingroup branch lengths are disproportionately long. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 6 in A molecular phylogeny of nephilid spiders: Evolutionary history of a model lineage
Fig. 6. Typical web architectures of the six nephilid genera mirroring the phylogenetic results: (a) Nephila (N. pilipes); (b) Nephilingis (N. n. sp. from Seychelles); (c) ''Nephila'' (N. inaurata); (d) Herennia (H. multipuncta); (e) Nephilengys (N. papuana); (f) Clitaetra (C. episinoides).
Fig. 5. A in A molecular phylogeny of nephilid spiders: Evolutionary history of a model lineage
Fig. 5. A summary nephilid phylogeny based on the Bayesian tree in Fig. 2 with squares at terminals color coded according to biogeographical regions (see right map inset). Branches are also color coded for geography, with the ancestral values inferred using parsimony optimization. Although the tree is not ultrametric (all terminals are in fact contemporary) the roughly estimated main clade ages are labeled according to the scheme A in Fig. 4. The nephilid ancestral age is thus between 40 and 60 million years when the Gondwanan continents were already largely split (see left map inset).
Fig. 2 in A molecular phylogeny of nephilid spiders: Evolutionary history of a model lineage
Fig. 2. Summary results from the analyses of the molecular matrices. The topology is from the Bayesian analysis of the full matrix partitioned by gene, with posterior probability values above 95% labeled with green dots at nodes. The nine squares on branches summarize the results of the alternative analyses using maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (BI) on different matrices and partition schemes (key in upper part of legend). Bar colors are indicative of clade support (key in lower part of legend) with solid squares indicating high support, gray squares indicating low support, and empty squares indicating a clade not recovered. Terminal legend as in Fig. 1, but with additional families (from top: MIC = Micropholcommatidae, NIC = Nicodamidae, MYS = Mysmenidae, MIM = Mimetidae, CYA = Cyatholipidae, MAL = Malkaridae, ANA = Anapidae, HOL = Holarchaeidae, SYM = Symphytognathidae, SYN = Synotaxidae). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 4 in A molecular phylogeny of nephilid spiders: Evolutionary history of a model lineage
Fig. 4. Chronograms obtained under three different calibration schemes: (a) the fossil Nephila jurassica treated as stem orbicularian (red); (b) N. jurassica treated as stem nephilid (green); (c) N. jurassica treated as stem Nephila sensu stricto as implied by the original description (black). Inset plot shows posterior distribution of the ucld.mean parameter for each calibration scheme (color codes as in trees). The arrow and the dotted area in the plot indicate the mean and 95% interval of the ucld.mean estimated by Bidegaray-Batista and Arnedo (2011). Only the scheme shown in a falls roughly within the expected mitochondrial substitution rates. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 1. A in A molecular phylogeny of nephilid spiders: Evolutionary history of a model lineage
Fig. 1. A pictorial summary of nephilid phenotypic diversity (right, a–h), and a strict consensus of 36 trees resulting from parsimony analyses combining molecular markers (full matrix) with morphology (left). The three sets of squares on branches represent node supports from alternative analyses, as follows: the left set corresponds to the parsimony jackknife support for the full (above branch) and Gblocked (Gb, below) matrices, respectively. The middle bar shows maximum likelihood (ML) bootstrap support of the full matrix under the full codon partition scheme. The right set indicates the Bremer supports for the different partitions (PBS) on the reference tree: above branches, from left to right, values for morphology + behavior, followed by the Bremer support values for the nuclear genes and below branches for the mitochondrial genes. See legend for support thresholds.Terminals have the first three letters of current taxonomic familial placement (from bottom:NEP = Nephilidae, ARA = Araneidae, TET = Tetragnathidae, NES = Nesticidae, THE = Theridiidae, THS = Theridiosomatidae, PIM = Pimoidae, LIN = Linyphiidae, DEI = Deinopidae, ULO = Uloboridae). The ingroup, nephilid part of the tree is colored in green and the ingroup terminals are colored according to the accepted nomenclature prior to the classification changes in the current study. Terminals with original molecular data end with specimen codes (as in Table 1), those with data from GenBank end with GB, and those for which only morphological (and behavioral) data were used are labeled M.
Figure 4 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
Figure 4. The historical biogeography of Liphistius. A, chronogram and ancestral area reconstructions for Liphistius. The numbers in front of the names of taxa correspond to those in Table 1. B, distribution routes of the trang species group (red arrows) and the bristowei species group (blue arrows). Areas are as follows: A = Mainland Sibumasu; B = Peninsular Sibumasu; C = Inthanon region; D = Central basin; E = Bentong–Reaub suture zone; F = Sukhothai terrain; G = Chantaburi region; H = Indochina terrain (based on Metcalfe 2017); I = East Asia [the distributions of all heptatheline taxa combined into a single area (not shown)].
Figure 3 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
Figure 3. Results of eight species delimitation methods. Each vertical bar represents a different delimitation method, and each horizontal bar represents a putative delimited species. Taxa 1–5 are each represented by only a single specimen. The colours in the phylogenetic tree represent Liphistius species groups, as follows: red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in Sibumasu; blue, trang group from localities in Indochina.
Figure 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
Figure 2. Multi-locus phylogeny using Bayesian inference (BI) with 'GBLOCK partition' alignments. Dashed lines show incongruent clades between Bayesian inference and maximum likelihood (ML). Coloured branches on the tree correspond to Liphistius species groups as follows: red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in Sibumasu; blue, trang group from localities in Indochina.
Figure 1 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
Figure 1. Distribution map of Liphistius. A, sample collection localities. Numbered collection locations correspond to those in Table 1. B, geological terrain: Sibumasu in the west (purple) and Indochina in the east (blue).
Table 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
<p><b>Table 2.</b> Primers used and their annealing temperatures.</p><table><tbody><tr><th><b>Gene</b></th><th><b>Primer</b></th><th><b>Sequence (5</b> <i>ʹ</i> <b>–3</b> <i>ʹ</i><b>)</b></th><th><b>Annealing temperature (°C)</b></th><th><b>Reference</b></th></tr></tbody><tbody><tr><th><i>CO1</i></th><td>LCO1490</td><td>GGTCAACAAATCATAAAGATATTGG</td><td>40</td><td>Folmer <i>et al</i>. (1994)</td></tr><tr><th></th><td>HCO2198</td><td>TAAACTTCAGGGTGACCAAAAAATCA</td><td>40</td><td>Folmer <i>et al</i>. (1994)</td></tr><tr><th>16S</th><td>16Sar</td><td>ATAGAGCTCCCATGGCGCCTGTTTAT CAAAAACAT</td><td>54</td><td>Huber <i>et al</i>. (1993)</td></tr><tr><th></th><td>16Sbr</td><td>ATAGAGCTCCCATGGCCGGTCTGAA CTCAGATCACGT</td><td>54</td><td>Huber <i>et al</i>. (1993)</td></tr><tr><th>ITS2</th><td>ITS-5.8S</td><td>GGGACGATGAAGAACGCAGC</td><td>47</td><td>White <i>et al</i>. (1990)</td></tr><tr><th></th><td>ITS-28S</td><td>TCCTCCGCTTATTGATATGC</td><td>47</td><td>White <i>et al</i>. (1990)</td></tr><tr><th>28S</th><td>28S-O</td><td>GAAACTGCTCAAAGGTAAACGG</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th></th><td>28S-C</td><td>GGTTCGATTAGTCTTTCGCC</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th><i>H3</i></th><td>H3aF</td><td>ATGGCTCGTACCAAGCAGACVGC</td><td>50</td><td>Colgan <i>et al</i>. (1998)</td></tr><tr><th></th><td>H3aR</td><td>ATATCCTTRGGCATRATRGTGAC</td><td>50</td><td>Colgan <i>et al</i>. (1998)</td></tr></tbody></table>
FIGURE 11 in Salticid spider phylogeny revisited, with the discovery of a large Australasian clade (Araneae: Salticidae)
FIGURE 11. Phylogenetic analyses of 16S–ND1sequences. Tree shown is majority rules consensus of trees sampled from the Bayesian analysis of 24–6 aligned data. Spots show strength of support with 24–6 and 8–4 alignments. Darkness of spot shows estimated posterior probability of clade. Footnotes: 1 Tomocyrba excluded from clade. 2 Naphrys and Myrmarachne excluded from clade. 3 Hispo included in clade.
FIGURE 10 in Salticid spider phylogeny revisited, with the discovery of a large Australasian clade (Araneae: Salticidae)
FIGURE 10. Phylogenetic analyses of 28S sequences. Tree shown is majority rules consensus of trees sampled from the Bayesian analysis of 24–6 aligned data. Spots show strength of support with 24–6 and 8–4 alignments. Darkness of spot shows estimated posterior probability of clade. Footnotes: 1 Orthrus included in clade. 2 Mantisatta included in clade. 3 Carrhotus sp. (Phil.) excluded from clade.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.