Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
152
datasets available to search
ShareScore release 0.9.0
Dataset results
152 results for “Ancient DNA”
Data sharing in Human ancient DNA studies
<p>The dataset contains information on data sharing regarding mitochondrial, Y chromosomal and autosomal polymorphisms in a total of 162 papers on ancient human DNA published between 1988 and 2013.</p>
Marine Sedimentary Ancient DNA (sedaDNA) from the North Atlantic Ocean
<p>Filtered sedimentary ancient DNA data (megan files), that includes sequence counts per sample. Additionally, scripts for the correlation analysis and heatmap are included. </p>
High resolution ancient sedimentary DNA shows that alpine plant diversity is associated with human land use and climate change
<p>The European Alps are highly rich in species, but their future may be threatened by ongoing changes in human land use and climate. Here, we reconstructed vegetation, temperature, human impact and livestock over the past ~12,000 years from Lake Sulsseewli, based on sedimentary ancient plant and mammal DNA, pollen, spores, chironomids, and microcharcoal. We assembled a highly-complete local DNA reference library (PhyloAlps, 3,923 plant taxa), and used this to obtain an exceptionally rich <em>sed</em>aDNA record of 366 plant taxa. Vegetation mainly responded to climate during the early Holocene, while human activity had an additional influence on vegetation from 6 ka onwards. Land-use shifted from episodic grazing during the Neolithic and Bronze Age to agropastoralism in the Middle Ages. Associated human deforestation allowed the coexistence of plant species typically found at different elevational belts, leading to levels of plant richness that characterise the current high diversity of this region. Our findings indicate a positive association between low-intensity agropastoral activities and precipitation with the maintenance of the unique subalpine and alpine plant diversity of the European Alps.</p>
Fig. 1. Deuterodon pedri, MCZ 21081 in Using ancient DNA to unravel taxonomic puzzles: the identity of Deuterodon pedri (Ostariophysi: Characidae)
Fig. 1. Deuterodon pedri, MCZ 21081, lectotype, 78.56 mm SL and original labels.
Inventory of ancient environmental DNA from sedimentary archives: locations, methods, and target taxa
<p>Locations of sampling sites from sedimentary ancient environmental DNA (aeDNA) studies. aeDNA is DNA that has degraded into short fragments, exhibits post-mortem damage signatures, and is recovered from a non-living tissue, organism, or environmental sample. Here we focus on sedimentary archives with contiguous records such as lake and marine sediments, permafrost, middens, cave sediments, soils, and incidental associated surface sediment samples used to interpret sedimentary archives. Studies span historic and ancient time periods using a variety of DNA-based methods (i.e., metabarcoding, shotgun sequencing, target capture, qPCR, ddPCR, and others) to study taxa from microorganisms to plants and mammals.</p>
Imputed data from for predicting skeletal stature using ancient DNA
<p>These are the three imputed genotype datasets from the following publication. Please consult the paper for details of the imputation approach, metadata for the samples, and the original data sources. These data are freely available but you should cite the original sources, as well as our paper. </p> <p>Predicting skeletal stature using ancient DNA; Cox S, Moots HM, Stock JT, Shbat A, Bitarello B, Nicklisch N, Alt K, Haak W, Rosenstock E, Ruff CB, Mathieson I; American Journal of Biological Anthropology, Jan 2022. <a href="https://doi.org/10.1002/ajpa.24426">https://doi.org/10.1002/ajpa.24426</a></p> <p> </p> <p> </p>
Aligned and curated mtDNA sequences from: Ancient DNA of narrow-headed voles reveals common features of the Late Pleistocene population dynamics in cold-adapted small mammals
<p><span>Narrow-headed vole, together with collared lemming and common vole, was the most abundant small mammal species across Eurasian Late Pleistocene steppe-tundra environments. Previous ancient DNA studies of </span><span>the latter</span><span> </span><span>two</span><span> revealed dynamic past population histories shaped by climatic fluctuations. To investigate the extent to which species with similar adaptations share common evolutionary </span><span>histories,</span><span> we generated a dataset comprising mitochondrial genomes of 139 ancient and 6 modern narrow-headed voles from multiple sites across Europe and north-</span><span>western</span><span> Asia and covering the last ca. 100 thousand years (ka). We inferred Bayesian time-aware phylogenies using 11 </span><span>radiocarbon-dated</span><span> samples for calibration of the molecular clock. We found that across the three </span><span>species,</span><span> divergence of the main mtDNA lineages occurred during Marine Isotope Stages (MIS) 7 and MIS 5, suggesting a common response </span><span>of species adapted to open habitat to the interglacial environments. </span><span>In European narrow-headed voles, we identified multiple </span><span>time-structured</span><span> mtDNA lineages, implying lineage turnovers. Timing of some of these turnovers was synchronous across all three </span><span>species,</span><span> allowing us to identify the main drivers of the Late Pleistocene dynamics of steppe- and cold-adapted species.</span></p>
IBD segments of previously published Eurasian individuals from "Accurate detection of identity-by-descent segments in human ancient DNA""
<p>IBD segments among 4,248 previously published Eurasian individuals. For details please refer to our manuscript. </p>
Fungus and plant sedimentary ancient DNA metabarcoding data from five lakes in Siberia
Open the record for dataset details and reuse information.
Bayesian inference under the multispecies coalescent with ancient DNA sequences
Open the record for dataset details and reuse information.
High resolution ancient sedimentary DNA shows that alpine plant diversity is associated with human land use and climate change
Open the record for dataset details and reuse information.
Data from: The history of tree and shrub taxa on Bol'shoy Lyakhovsky Island (New Siberian Archipelago) since the last interglacial uncovered by sedimentary ancient DNA and pollen data
Open the record for dataset details and reuse information.
Millennia of metacommunity diversification and homogenization captured by sedimentary ancient DNA
Open the record for dataset details and reuse information.
Data from: Phylogenetic diversity and environment form assembly rules for Arctic diatom genera—a study on recent and ancient sedimentary DNA
Open the record for dataset details and reuse information.
Aligned and curated mtDNA sequences from: Ancient DNA of narrow-headed voles reveals common features of the Late Pleistocene population dynamics in cold-adapted small mammals
Open the record for dataset details and reuse information.
Ancient DNA sheds light on the funerary practices of late Neolithic collective burial in southern France
Open the record for dataset details and reuse information.
Diatom sedimentary ancient DNA metabarcoding from western Fram Strait and Kronotsky Peninsula
<p>In this study we use sedimentary ancient DNA metabarcoding from two marine sediment cores. The first Kastenlot core MSM05/5-712-2 was taken at western Fram Strait (subarctic North Atlantic) from which we collected 12 samples including one biological replicate. The second Kastenlot core SO201-2-12KL was retrieved from Kamchatka Strait (subarctic North Pacific) from which we collected 9 samples and 2 samples were collected from a pilot core taken next to the Kastenlot core. Total DNA was extracted from approximately 2ml sediment per sample in 3 batches with up to 9 samples and one extraction blank. Total DNA was concentrated and if necessary diluted to 2.5 ng/µl. For each batch we performed PCRs in triplicates including a PCR no template control (NTC). We amplified a diatom-specific, 76 bp long part of the rbcL gene with tagged primers Diat_rbcL_705F (AACAGGTGAAGTTAAAGGTTCATAYTT) and Diat_rbcL_808R (TGTAACCCATAACTAAATCGATCAT). The PCR-products were purified and pooled in equal concentrations. The sequencing library was prepared with the Mid Output kit v. 2 according to the Fasteris Metafast protocol for low complexity amplicon sequencing and checked by qPCR. The library was sequenced (2 x 150 bp, paired-end) on the Illumina NextSeq 500 at the Fasteris SA sequencing service (Switzerland). For two samples we sequenced 4 PCR-products and for two samples we could only get 2 PCR-products with sufficient DNA content for sequencing.</p>
Raw data for predicting sample success for large-scale ancient DNA studies on marine mammals
<p>In recent years, non-human ancient DNA studies have begun to focus on larger sample sizes and whole genomes, offering the potential to reveal exciting and hitherto unknown answers to ongoing biological and archaeological questions. However, one major limitation to the feasibility of such studies is the substantial financial and time investments still required during sample screening, due to uncertainty regarding successful sample selection. This study investigates the effect of a wide range of sample properties including latitude, sample age, skeletal element, collagen preservation, and context on endogenous content and DNA damage profiles for 317 ancient and historic pinniped samples collected from across the North Atlantic. Using generalised linear and mixed-effect models, we found that a range of factors affected DNA preservation within each of the species under consideration. The most important findings were that endogenous content varied significantly according to context, the type of skeletal element, the collagen content and collection year. There also appears to be an effect of the sample's geographic origin, with samples from the Arctic generally showing higher endogenous content and lower damage rates. Both latitude and sample age were found to have significant relationships with damage levels, but only for walrus samples. Sex, ontogenetic age and extraction material preparation were not found to have any significant relationship with DNA preservation. Overall, the skeletal element and sample context were found to be the most influential factors and should therefore be considered when selecting samples for large-scale ancient genome studies.</p>
Plant sedimentary ancient DNA data from Far East Russia
<p>Woody plants are expanding into the Arctic in response to the warming climate. The impact on arctic plants is not well understood due to the limited knowledge about plant assembly rules. Past plant diversity over long time series is rare. Here, we applied sedimentary ancient DNA metabarcoding targeting the P6 loop of the chloroplast <i>trnL</i> gene to a sediment record from Lake Ilirney (central Chukotka, Far Eastern Russia) covering the last 28 thousand years. Our results show that forb-rich steppe-tundra and dwarf-shrub tundra dominated during the cold climate before 14 ka, while deciduous erect-shrub tundra was abundant during the warm period since 14 ka. <i>Larix</i> invasion during the late Holocene substantially lagged behind the likely warmest period between 10 and 6 ka, where the vegetation coverage was densest. We reveal highest richness during 28–23 ka and a second richness peak during 13–10 ka, with both periods being accompanied by low shrub abundance. During the cold period before 14 ka, rich communities were phylogenetically clustered, suggesting low genetic divergence in the communities despite the great number of species. This probably originates from environmental filtering along with niche differentiation due to limited resources under harsh environmental conditions. In contrast, during the warmer period after 14 ka, rich communities were phylogenetically overdispersed. This results from a high number of species which were found to harbor high genetic divergence, likely originating from an erratic recruitment process in the course of warming. Some of our evidence may be of relevance for inferring future arctic plant assembly rules and diversity changes. By analogy to the past, we expect a lagged response of tree invasion. Plant richness may overshoot in the short term; in the long-term, however, the ongoing expansion of deciduous shrubs will eventually result in a phylogenetically more diverse community.</p>
Data from: An assessment of ancient DNA preservation in Holocene-Pleistocene fossil bone excavated from the world heritage Naracoorte Caves, South Australia
Although there is a long history of research into the fossil deposits of the Naracoorte Caves (South Australia), ancient DNA (aDNA) has not been integrated into any palaeontological study from this World Heritage site. Here, we provide the first evidence of aDNA preservation in Holocene- and Pleistocene-aged fossil bone from a deposit inside Robertson Cave. Using a combination of metabarcoding and shotgun next-generation sequencing approaches, we demonstrate that aDNA from diverse taxa can be retrieved from bulk bone as old as 18 600 cal a BP. However, the DNA is highly degraded and contains a lower relative proportion of endogenous sequences in bone older than 8400 cal a BP. Furthermore, modelling of DNA degradation suggests that the decay rate is rapid, and predicts a very low probability of obtaining informative aDNA sequences from extinct megafaunal bones from Naracoorte (ca. 50 000 cal a BP). We also provide new information regarding the past faunal biodiversity of Robertson Cave, including families that have not been formerly described in the fossil record from here before. Collectively, these data demonstrate the potential for future aDNA studies to be conducted on material from Naracoorte, which will aid in the understanding of faunal turnover in southern Australia.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.