Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
152
datasets available to search
ShareScore release 0.9.0
Dataset results
152 results for “ITS2”
FIGURE 3 Bayesian consensus tree representing the known Bathynellidae taxa constructed using COI, 16S, 28S, ITS2 and 18S in The role of allopatric speciation and ancient origins of Bathynellidae (Crustacea) in the Pilbara (Western Australia): two new genera from the De Grey River catchment
FIGURE 3 Bayesian consensus tree representing the known Bathynellidae taxa constructed using COI, 16S, 28S, ITS2 and 18S alignments and model partitioning implemented in MrBayes. Numbers on branches represent Bayesian posterior probabilities followed by maximum likelihood bootstrap percentage. Bathynellinae and Gallobathynellinae clades are collapsed for easier interpretation.
FIGURE 2 Bayesian consensus single gene trees for COI, 16S, 28S and ITS2 in The role of allopatric speciation and ancient origins of Bathynellidae (Crustacea) in the Pilbara (Western Australia): two new genera from the De Grey River catchment
FIGURE 2 Bayesian consensus single gene trees for COI, 16S, 28S and ITS2. Numbers on branches represent Bayesian posterior probabilities followed by maximum likelihood bootstrap percentage. ABGD and PTP results are reported next to the trees. ABGD method: major partitions are showed; PTP: partitions with the highest support for each group are represented.
rCRUX Generated ITS2 Plants Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: ITS2 Plants<br> Gene: ITS2<br> Length of Target: 450-550<br> get_seeds_local() minimum length: 315<br> get_seeds_local() maximum length: 600<br> blast_seeds() minimum length: 270<br> blast_seeds() maximum length: 560<br> max_to_blast: 100<br> Forward Sequence (5'-3'): ATGCGATACTTGGTGTGAAT<br> Reverse Sequence (5'-3'): GACGCTTCTCCAGACTACAAT<br> Reference: Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... & Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818. <a href="https://doi.org/10.1371/journal.pone.0067818">https://doi.org/10.1371/journal.pone.0067818</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
Data from: Feasibility of nuclear ribosomal region ITS1 over ITS2 in barcoding taxonomically challenging genera of subtribe Cassiinae (Fabaceae)
Premise of the Study The internal transcribed spacer (ITS) region is situated between 18S and 26S in a polycistronic rRNA precursor transcript. It had been proved to be the most commonly sequenced region across plant species to resolve phylogenetic relationships ranging from shallow to deep taxonomic levels. Despite several taxonomical revisions in Cassiinae, a stable phylogeny remains elusive at the molecular level, particularly concerning the delineation of species in the genera Cassia, Senna and Chamaecrista. This study addresses the comparative potential of ITS datasets (ITS1, ITS2 and concatenated) in resolving the underlying morphological disparity in the highly complex genera, to assess their discriminatory power as potential barcode candidates in Cassiinae. Methodology A combination of experimental data and an in-silico approach based on threshold genetic distances, sequence similarity based and hierarchical tree-based methods was performed to decipher the discriminating power of ITS datasets on 18 different species of Cassiinae complex. Lab-generated sequences were compared against those available in the GenBank using BLAST and were aligned through MUSCLE 3.8.31 and analysed in PAUP 4.0 and BEAST1.8 using parsimony ratchet, maximum likelihood and Bayesian inference (BI) methods of gene and species tree reconciliation with bootstrapping. DNA barcoding gap was realized based on the Kimura two-parameter distance model (K2P) in TaxonDNA and MEGA. Principal Findings Based on the K2P distance, significant divergences between the inter- and intra-specific genetic distances were observed, while the presence of a DNA barcoding gap was obvious. The ITS1 region efficiently identified 81.63% and 90% of species using TaxonDNA and BI methods, respectively. The PWG-distance method based on simple pairwise matching indicated the significance of ITS1 whereby highest number of variable (210) and informative sites (206) were obtained. The BI tree-based methods outperformed the similarity-based methods producing well-resolved phylogenetic trees with many nodes well supported by bootstrap analyses. Conclusion The reticulated phylogenetic hypothesis using the ITS1 region mainly supported the relationship between the species of Cassiinae established by traditional morphological methods. The ITS1 region showed a higher discrimination power and desirable characteristics as compared to ITS2 and ITS1 + 2, thereby concluding to be the locus of choice. Considering the complexity of the group and the underlying biological ambiguities, the results presented here are encouraging for developing DNA barcoding as a useful tool for resolving taxonomical challenges in corroboration with morphological framework.
Symbiodiniaceae ITS2 sequences from reef corals in St. John, U.S. Virgin Islands
<p>Monitoring coral cover can describe the ecology of reef degradation, but rarely can it reveal the proximal mechanisms of change, or achieve its full potential in informing conservation actions. Describing temporal variation in Symbiodiniaceae within corals can help address these limitations, but this is rarely a research priority. Here, we augmented an ecological time series of the coral reefs of St. John, US Virgin Islands, by describing the genetic complement of symbiotic algae in common corals. Seventy-five corals from 9 species were marked and sampled in 2017, and following hurricanes in September 2017, 41% were sampled in 2018, and 72% in 2019; 28% could not be found and were assumed to have died. Symbiodiniaceae ITS2 sequencing identified 525 distinct sequences (comprising 42 ITS2 type profiles), and symbiont diversity differed among host species and individuals, but was in most cases preserved within hosts over 3 yrs that were marked by physical disturbances from major hurricanes and the onset of stony coral tissue loss disease. While changes in symbiont communities were slight and stochastic over time within colonies, variation in the dominant symbionts among colonies was observed for all host species. Together these results indicate that declining host abundances could lead to the loss of rare algal lineages that are found in a low proportion of few coral colonies left on many reefs, especially if coral declines are symbiont-specific. These findings highlight the importance of identifying Symbiodiniaceae as part of a time series of coral communities to support holistic conservation planning. Repeated sampling of tagged corals is unlikely to be viable for this purpose, because many Caribbean corals are dying before they can be sampled multiple times. Instead, random sampling of large numbers of corals may be more effective in capturing the diversity and temporal dynamics of Symbiodiniaceae metacommunities in reef corals.</p>
Fig. 4. Maximum parsimony consensus tree within Paromoionchis gen. nov., performed with ITS2 DNA sequences from 80 in A new genus and three new species of mangrove slugs from the Indo-West Pacific (Mollusca: Gastropoda: Euthyneura: Onchidiidae)
Fig. 4. Maximum parsimony consensus tree within Paromoionchis gen. nov., performed with ITS2 DNA sequences from 80 individuals (including 7 outgroups). Numbers by the branches are the bootstrap values (only numbers> 50% are indicated). Numbers for each individual correspond to unique identifiers for DNA extraction. All sequences for specimens of Paromoionchis gen. nov. are new. Information on specimens can be found in the lists of material examined and in Table 1. The letter A corresponds to a clade referred to in the text. The color used for each (mitochondrial) unit is the same as that used in Figs 1–3 and 5–6.
Fig. 3. Maximum parsimony consensus tree within Paromoionchis gen. nov., performed with concatenated ITS2 and 28S DNA sequences from 41 in A new genus and three new species of mangrove slugs from the Indo-West Pacific (Mollusca: Gastropoda: Euthyneura: Onchidiidae)
Fig. 3. Maximum parsimony consensus tree within Paromoionchis gen. nov., performed with concatenated ITS2 and 28S DNA sequences from 41 individuals (including 7 outgroups). Numbers by the branches are the bootstrap values (only numbers> 50% are indicated). Numbers for each individual correspond to unique identifiers for DNA extraction. All sequences for specimens of Paromoionchis gen. nov. are new. Information on specimens can be found in the lists of material examined and in Table 1. Letters A and B correspond to clades referred to in the text. The color used for each (mitochondrial) unit is the same as that used in Figs 1–2 and 4–6.
ITS2 Crop database
<p>A reference database for the European crops created using BCdatabaser with the following parameters:</p> <ul> <li>100 sequences per species</li> <li>sequencing length: 100 - 2000 bp</li> </ul> <p>This database was curated using a curation pipeline workflow available in GitHub.</p> <p>If you use this dataset, please cite Quaresma et al. 2024, Scientific Data, DOI: 10.1038/s41597-024-02962-5</p>
Symbiodiniaceae ITS2 sequences from reef corals in St. John, U.S. Virgin Islands
Open the record for dataset details and reuse information.
Data from: Feasibility of nuclear ribosomal region ITS1 over ITS2 in barcoding taxonomically challenging genera of subtribe Cassiinae (Fabaceae)
Open the record for dataset details and reuse information.
FIGURE 17. ITS2 gene tree. G in Crickets of the genus Gryllus in the United States (Orthoptera: Gryllidae: Gryllinae)
FIGURE 17. ITS2 gene tree. G. brevicaudus samples: S03-8 (G5); S16-1 (G3354, G3393); G. insularis samples: Guadalupe Island, Baja California Norte, Mexico; G. bryanti samples: Andros Island, Bahamas; G. alexanderi sample: Clarion Island, Colima, Mexico.
FIGURE 115. ITS2 gene tree. G in Crickets of the genus Gryllus in the United States (Orthoptera: Gryllidae: Gryllinae)
FIGURE 115. ITS2 gene tree. G. vernalis samples: S03-56 (G27, G1739); S03-62 (G31, G33). G. fultoni samples: S03-62 (G32, G34); S03-64 (G35), S07-22 (G1138).
FIGURE 4 in Evolution, characterization and phylogenetic utility of ITS2 gene in Orthoptera and some Polyneoptera: Highly variable at the order level and highly conserved at the species level
FIGURE 4. Maximum likelihood trees obtained from the data sets of linear sequences (L-ML; left) and secondary structures (S-ML; right). The non-CBCs (*) and hemi-CBCs (**) showed on the S-ML tree.
FIGURE 3 in Evolution, characterization and phylogenetic utility of ITS2 gene in Orthoptera and some Polyneoptera: Highly variable at the order level and highly conserved at the species level
FIGURE 3. Secondary structure of ITS2 in the Anterastes genus (conserved motifs of helix III showed in dashed boxes and U-U mismatch of helix II in dotted boxes; A—A. antitauricus, B—A. uludaghensis, C—A. serbicus).
FIGURE 1 in Evolution, characterization and phylogenetic utility of ITS2 gene in Orthoptera and some Polyneoptera: Highly variable at the order level and highly conserved at the species level
FIGURE 1. Secondary structure of ITS2 in Polyneoptera taxa (conserved motifs of helix III showed in dashed boxes and U-U mismatch of helix II in dotted boxes; A—Blatella germanica, B—Mantis religiosa, C—Coptotermes formosanus, D—Oligotoma sp., E—Timema cristinae).
Microsatellite genotypes and ITS2 DNA sequence data for Seriatopora hystrix
<p>Coral reefs provide essential goods and services but are degrading at an alarming rate due to local and global anthropogenic stressors. The main limitation that prevents the implementation of adequate conservation measures is that connectivity and genetic structure of populations are poorly known. Here, the genetic diversity and connectivity of the brooding scleractinian coral, <i>Seriatopora hystrix</i> were assessed at two scales by genotyping ten microsatellite markers for 356 individual colonies. Seriatopora hystrix showed high differentiation, both at large scale between the Red Sea and the Western Indian Ocean (WIO), and at smaller scale along the coast of East Africa.As such high levels of differentiation might indicate the presence of more than one species, a haploweb analysis was conducted with the nuclear marker ITS2, confirming that the Red Sea populations are genetically distinct from the WIO ones.Based on microsatellite analyses three groups could be distinguished within the WIO: (I) north Madagascar, (II) south-west Madagascar together with one site in northern Mozambique (Nacala), and (III) all other sites in northern Mozambique, Tanzania and Kenya. These patterns of restricted connectivity could be explained by the short pelagic larval duration of <i>S. hystrix,</i> and/or by oceanographic factors, such as eddies in the Mozambique Channel (causing larval retention in northern Madagascar but facilitating dispersal from northern Mozambique towards south-west Madagascar). This study provides an additional line of evidence supporting the conservation priority status of the Northern Mozambique Channel and should inform coral reef management decisions in the region.</p> <p> </p>
FIGURE 1. Maximum likelihood tree for cytb and ITS2 in Contributions to Disholcaspis Dalla Torre And Kieffer (Hymenoptera: Cynipidae: Cynipini)
FIGURE 1. Maximum likelihood tree for cytb and ITS2, for known species of Disholcaspis and unidentified specimens. Names starting with "D_" represent specimens from Nicholls et al. (2017). Names starting with USNM are newly collected; those in blue (only) can be assigned to previously-described species based on phylogenetic placement, genetic distances, and host plant data. Bootstrap values above 50% are shown to the left of the nodes.
FIGURE 7. ITS2 in A systematic revision of Draculoides (Schizomida: Hubbardiidae) of the Pilbara, Western Australia, Part I: the Western Pilbara
FIGURE 7. ITS2 mini-barcodes for all Draculoides species including the operational taxonomic units used in Abrams et al. (2019). This barcode is the maximally diagnostic 50 bp fragment of DNA. Genetic variation within species is shown using IUPAC Ambiguity Codes. See Methods for details. The position of the mini-barcode is reported relative to a specimen of Draculoides celatus (WAM T98698, GenBank number MG913105). The blue tree on the left groups minibarcodes which are most similar to each other but does not represent an accurate phylogeny. The coloured bases in the figure are those that differ from the consensus reference sequence.
FIGURE 2. Maximum likelihood tree using 28S D2 & D3–5, ITS2 in Read between the lineata: A revision of the tattooed wasps, Zagrammosoma Ashmead (Hymenoptera: Eulophidae), with descriptions of eleven new species
FIGURE 2. Maximum likelihood tree using 28S D2 & D3–5, ITS2, and COI NJ. Bootstrap values shown. The varying colors within Zagrammosoma indicate different species.
Data from: Intragenomic ITS2 variation in a genus of parasitoid wasps (Hymenoptera: Braconidae): implications for accurate species delimitation and phylogenetic analysis
A recent DNA barcoding study of Australian microgastrines (Hymenoptera: Braconidae) sought to use next generation sequencing of the cytochrome c oxidase subunit 1 (COI) barcoding gene region, the wingless (WG) gene and the internal transcribed spacer 2 (ITS2) to delimit molecular species in a highly diverse group of parasitic wasps. Large intragenomic distances between ITS2 variants, often larger than the average interspecific variation, caused difficulties in using ITS2 for species delimitation in both threshold and tree‐based approaches, and the gene was not included in the reported results of the previous DNA barcoding study. We here report on the intragenomic, and the intra‐ and interspecies, variation in ITS2 in the microgastrine genus Diolcogaster to further investigate the value of ITS2 as a marker for species delimitation and phylogenetics of the Microgastrinae. Distinctive intragenomic variant patterns were found in different species of Diolcogaster, with some species possessing a single major variant, and others possessing many divergent variants. Characterising intragenomic variation of ITS2 is critical as it is a widely used marker in hymenopteran phylogenetics and species delimitation, and large intragenomic distances such as those found in this study may obscure phylogenetic signal.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.