Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
1,334
datasets available to search
ShareScore release 0.9.0
Dataset results
1,334 results for “Himalayas”
FIGURES 30–36 in A new whitefly genus and species, Himalayaleyrodes sarcococcae Dubey (Hemiptera: Aleyrodidae) infesting Christmas box (Buxaceae) in Western Himalaya, India
FIGURES 30–36. Himalayaleyrodes sarcococcae Dubey sp. nov., SEM photomicrographs, puparium and adult male, 30, puparium, ventral view; 31, caudal tracheal fold, stipples; 32, microseta at leg base; 33, thoracic legs; 34, thoracic tracheal fold; 35, spiracle, stipples; 36, adult male genitalia.
FIGURES 23–29 in A new whitefly genus and species, Himalayaleyrodes sarcococcae Dubey (Hemiptera: Aleyrodidae) infesting Christmas box (Buxaceae) in Western Himalaya, India
FIGURES 23–29. Himalayaleyrodes sarcococcae Dubey sp. nov., SEM photomicrographs, puparium, 23, dorsal view; 24, marginal and submargin setae; 25, posterior abdominal area; 26, thoracic tracheal pore area; 27, geminate pore; 28, subdorsal band of wax gland, simple pores on band; 29, vasiform orifice.
Data for: Light-absorbing impurities in glacial environments over western Himalaya from reanalysis data and in situ observations
<p>The repository contains information about 6 aerosol variables extracted from MERRA-2 reanalysis over western Himalayan region of Jammu and Kashmir. It also contains data about glacier ice chemistry based on 9 physicochemical characteristics of 3 glaciers nestled in the Greater Himalayan Mountain range of Kashmir. Air mass back trajectories as simulated from HYSPLIT model on a seasonal basis are also provided.</p>
FIGURE 6 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)
FIGURE 6. Male genitalia of Cinygmula longissima sp. nov. A: genitalia (dorsal view); B: genitalia (ventral view); C: penes (dorsal view); D: penes (ventral view); E: titillators of penes; F: lateral spine
FIGURE 4 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)
FIGURE 4. Male imago of Cinygmula longissima sp. nov. A: habitus; B: legs (fore–, mid– and hindlegs from left to right and foreclaws enlarged); C: head (dorsal view); D: head (lateral view)
FIGURE 3 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)
FIGURE 3. Nymphal mouthparts of Cinygmula longissima sp. nov. A: labrum (dorsal view); B: left mandible (dorsal view); C: right mandible (dorsal view); D. hypopharynx (dorsal view); E: left maxilla (ventral view); F: labium (ventral view)
FIGURE 2 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)
FIGURE 2. Nymphal structures of Cinygmula longissima sp. nov. A: head of a mature nymph (showing the frontal fold in the shell, dorsal view); B: head capsule (showing the shape, dorsal view); C: fore–, mid– and hindleg (from above to bottom); D. Gills I–VII (from left to right)
Figs 3–9 in Review of the genus Chrysolina Motschulsky, 1860 (Coleoptera: Chrysomelidae) from Nepal Himalaya with description of a new species
Figs 3–9. Chrysolina, aedeagus structure: 3–7 — Ch. romandudkoi sp.n.; 8–9 — Ch. nagaja (Daccordi, 1982) from Solukhumbu Distr., env. Lamjura La Pass; 3, 8 — lateral view, 4, 6, 9 — dorsal view (4 — holotype), 5 — ventral view, 7 — view of the apex and apical orifice along the main axis (paratype). Scale bar — 1mm. Рис. 3–9. Chrysolina, строение Эдеагуса: 3–7 — Ch. romandudkoi sp.n.; 8–9 — Ch. nagaja (Daccordi, 1982) иЗ района Solukhumbu, окрестностей перевала Lamjura La; 3, 8 —сбоку, 4, 6, 9 —сверху (4 — голотип); 5 —сниЗу; 7 —верШина и апикальное отверстие вдоль продольной оси (паратип). МасШтаб — 1мм.
Figs 1–2. Chrysolina tangalaensis Kimoto, 2001 in Review of the genus Chrysolina Motschulsky, 1860 (Coleoptera: Chrysomelidae) from Nepal Himalaya with description of a new species
Figs 1–2. Chrysolina tangalaensis Kimoto, 2001, male, holotype, general dorsal and lateral view. Photo by Dr. Ako Tachi (Kyushu University, Fukuoka, Japan). Рис. 1–2. Chrysolina tangalaensis Kimoto, 2001, самец, голотип, обЩий вид сверху и сбоку. Фото д-ра Ако Тачи (Университет Кюсю, Фукуока, ЯпониЯ).
Figs 18–21 in Review of the genus Chrysolina Motschulsky, 1860 (Coleoptera: Chrysomelidae) from Nepal Himalaya with description of a new species
Figs 18–21. Chrysolina, general dorsal view: 18 — Ch. nagaja (Daccordi, 1982) from env. Lamjura La Pass; 19–21 — Ch. romandudkoi sp.n., paratypes (19–20 — males, 21 — female). Scale bar — 1mm. Рис. 18–21. Chrysolina, обЩий вид сверху: 18 — Ch. nagaja (Daccordi, 1982) иЗ окрестностей перевала Lamjura La; 19–21 — Ch. romandudkoi sp.n., паратипы (19–20 — самцы, 21 — самка). МасШтаб — 1мм.
Figs 10–17 in Review of the genus Chrysolina Motschulsky, 1860 (Coleoptera: Chrysomelidae) from Nepal Himalaya with description of a new species
Figs 10–17. Chrysolina, aedeagus: 10–11 — Ch. daccordii (L. Medvedev et Sprecher-Uebersax, 1999); 12–13 — Ch. hartmanni Medvedev, 1999; 14–15 — Ch. dhaulagirica dhaulagirica Medvedev, 1990; 16–17 — Ch. dhaulagirica arunensis Medvedev, 1992; 10, 12, 14, 16 — lateral view; 11, 13, 15, 17 — dorsal view [10–11 — after Bienkowski, 2013; 12–13 — after Medvedev, 1999; 14–15 — after Medvedev, 1990; 16–17 — after Medvedev, 1992, slightly modified]. Рис. 10–17. Chrysolina, Эдеагус сбоку и сверху: 10–11 — Ch. daccordii (L. Medvedev et Sprecher-Uebersax, 1999); 12–13 — Ch. hartmanni Medvedev, 1999; 14–15 — Ch. dhaulagirica dhaulagirica Medvedev, 1990; 16–17 — Ch. dhaulagirica arunensis Medvedev, 1992; 10, 12, 14, 16 — сбоку; 11, 13, 15, 17 — сверху [10–11 — по Bienkowski, 2013; 12–13 — по Medvedev, 1999; 14–15 — по Medvedev, 1990; 16–17 — по Medvedev, 1992, с небольШими иЗменениЯми].
Table 1 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species
<p><b>Table 1.</b> Primers used for PCR and sequencing</p><table><tbody><tr><th>Locus</th><th>Primer name</th><th>Primer sequences</th><th>Sense/anti-sense</th><th>Reference</th></tr></tbody><tbody><tr><th><i>CYT B</i></th><td>L14724_hk3</td><td>GGACTTATGACATGAAAAATCATCGTTG</td><td>Sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><td>H15915_hk3</td><td>GATTCCCCATTTCTGGTTTACAAGAC</td><td>Anti-sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><th>12S</th><td>L613_hk1</td><td>GGCGGGCGAGCAAAGCACTGAAAATG</td><td>Sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><td>H1478_hk1</td><td>TGATTGGTGGAGGGTGACGAGCGGTGTGT</td><td>Anti-sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><th><i>BRCA1</i></th><td>B1f</td><td>TGAGAACAGCACTTTATTACTCAC</td><td>Sense</td><td>Dubey <i>et al.</i>, 2006</td></tr><tr><td>B1r</td><td>ATTCTAGTTCCATATTGCTTATACTG</td><td>Anti-sense</td><td>Dubey <i>et al.</i>, 2006</td></tr><tr><th><i>APOB</i></th><td>ApoBf</td><td>GCAATCATTTGACTTAAGTG</td><td>Sense</td><td>Dubey <i>et al.</i>, 2007</td></tr><tr><td>ApoBr</td><td>GAGCAACAATATCTGATTGG</td><td>Anti-sense</td><td>Dubey <i>et al.</i>, 2007</td></tr><tr><th><i>RAG2</i></th><td>RAG2-F220</td><td>GATTCCTGCTAYCTYCCTCCTCT</td><td>Sense</td><td>Teeling <i>et al.</i>, 2000</td></tr><tr><td>RAG2-R995</td><td>CCCATGTTGCTTCCAAACCATA</td><td>Anti-sense</td><td>Teeling <i>et al.</i>, 2000</td></tr></tbody></table>
In situ characterization of dust storms and their snow darkening effect over Himalayas
<p>The dataset provided here pertains to the Mukteshwar region. Users are requested to acknowledge the data curators before utilizing it.</p>
Figure 2 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species
Figure 2. Dorsal, ventral and lateral views of the skull and lateral views of the mandible of the holotype of Alpiscaptulus medogensis (KIZ: 037966; left) and Scapanulus oweni (KIZ: 033872; right). Scale bar = 10 mm.
Figure 5 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species
Figure 5. Results of maximum likelihood phylogenetic analyses of concatenated (A) mitochondrial genes, (B) nuclear genes and (C) mitochondrial-nuclear trees. Node numbers indicate Bayesian posterior probabilities (PP) and ultrafast bootstrap supports (UFBoot). Branch lengths represent substitutions per site.
Subspecies and Distribution. V. v. vulpes Linnaeus, 1758 — N Europe (Scandinavia). V. v. abietorum Merriam, 1900 — SW Canada (Alberta & British Columbia). V. v. aegyptiacus Sonnini, 1816 — Egypt, Israel, and Lybia. V. v. alascensis Merriam, 1900 — Alaska and NW Canada (NW Territories & Yukon). V. v. alpheraky: Satunin, 1906 — Kazakhstan. V. v. anatolica Thomas, 1920 — Turkey. V. v. arabica Thomas, 1902 — Arabian peninsula. V. v. atlantica Wagner, 1841 — Algeria (forested Atlas Mts). V. v. bangsi Merriam, 1900 — NE Canada (Labrador). V. v. barbara Shaw, 1800 — NW Africa (Barbary Coast). V. v. beringiana Middendorff, 1875 — NE Siberia (shore of Bering Strait). V. v. cascadensis Merriam, 1900 — NW USA (Cascade Mountains, Oregon & Washington). V. v. caucasica Dinnik, 1914 — SW Russia (Caucasus). V. v. crucigera Bechstein, 1789 — Europe through N & C Russia. V. v. daurica Ognev, 1931 — E Russia (Amur, Siberia & Transbaikalia). V.v. deletrix Bangs, 1898 — NE Canada (Newfoundland). V. v. dolichocrania Ognev, 1926 — SE Siberia (S Ussuri). V. v. flavescens Gray, 1843 — N Iran. V. v. fulva Desmarest, 1820 — E USA. V. v. griffith: Blyth, 1854 — Afghanistan and N Pakistan. V.v. harrimani Merriam, 1900 — Alaska (Kodiak I). V. v. hoole Swinhoe, 1870 — S China (Fujian to Sichuan). V. v. ichnusae G. S. Miller, 1907 — Corsica and Sardinia. V. v. induta G. S. Miller, 1907 — Cyprus. V. v. jakutensis Ognev, 1923 — E Siberia (S of Yakutsk). V. v. japonica Gray, 1868 — Japan. V. v. karagan Erxleben, 1777 — Mongolia, Kazakhstan, and Kirgizstan. V. v. kenaiensis Merriam, 1900 — Alaska (Kenai Peninsula). V. v. kurdistanica Satunin, 1906 — Armenia and NE Turkey. V. v. macroura Baird, 1852 — USA (Mountain States). V. v. montana Pearson, 1836 — Himalayas form China (Yunnan) to C Pakistan. V. v. mecator Merriam, 1900 — SW USA (California & Nevada). V_ v. ochroxantha Ognev, 1926 — E Russian Turkestan, Aksai, Kirgizstan, Semirechie. V. v. palaestina Thomas, 1920 —Jordan and Lebanon. V.v. peculiosa Kishida, 1924 — Korea. V. v. pusilla Blyth, 1854 — NW India to Irak. V.v. regalis Merriam, 1900 — N Great Plains of Canada and USA. V. v. rubricosa Bangs, 1898 — E Canada. V.v. schrencki Kishida, 1924 — N Japan (Hokkaido) and NE Russia (Sakhalin). V. v. silacea G. S. Miller, 1907 — Iberian Peninsula. V.v. splendidissima Kishida, 1924 — E Russia (N & C Kurile Is). V. v. stepensis Brauner, 1914 — steppes of S Russia. V. v. tobolica Ognev, 1926 — Russia (lower basin of Ob River) V. v. tschiliensis Matschie, 1907 — NE China. Foxes of European origin were introduced into E USA and Canada in the 17" century, subsequently mixed with local subspecies. Also introduced to Australia in 1800s, and the Falkland Islands (Malvinas). in Canidae
Subspecies and Distribution. V. v. vulpes Linnaeus, 1758 — N Europe (Scandinavia). V. v. abietorum Merriam, 1900 — SW Canada (Alberta & British Columbia). V. v. aegyptiacus Sonnini, 1816 — Egypt, Israel, and Lybia. V. v. alascensis Merriam, 1900 — Alaska and NW Canada (NW Territories & Yukon). V. v. alpheraky: Satunin, 1906 — Kazakhstan. V. v. anatolica Thomas, 1920 — Turkey. V. v. arabica Thomas, 1902 — Arabian peninsula. V. v. atlantica Wagner, 1841 — Algeria (forested Atlas Mts). V. v. bangsi Merriam, 1900 — NE Canada (Labrador). V. v. barbara Shaw, 1800 — NW Africa (Barbary Coast). V. v. beringiana Middendorff, 1875 — NE Siberia (shore of Bering Strait). V. v. cascadensis Merriam, 1900 — NW USA (Cascade Mountains, Oregon & Washington). V. v. caucasica Dinnik, 1914 — SW Russia (Caucasus). V. v. crucigera Bechstein, 1789 — Europe through N & C Russia. V. v. daurica Ognev, 1931 — E Russia (Amur, Siberia & Transbaikalia). V.v. deletrix Bangs, 1898 — NE Canada (Newfoundland). V. v. dolichocrania Ognev, 1926 — SE Siberia (S Ussuri). V. v. flavescens Gray, 1843 — N Iran. V. v. fulva Desmarest, 1820 — E USA. V. v. griffith: Blyth, 1854 — Afghanistan and N Pakistan. V.v. harrimani Merriam, 1900 — Alaska (Kodiak I). V. v. hoole Swinhoe, 1870 — S China (Fujian to Sichuan). V. v. ichnusae G. S. Miller, 1907 — Corsica and Sardinia. V. v. induta G. S. Miller, 1907 — Cyprus. V. v. jakutensis Ognev, 1923 — E Siberia (S of Yakutsk). V. v. japonica Gray, 1868 — Japan. V. v. karagan Erxleben, 1777 — Mongolia, Kazakhstan, and Kirgizstan. V. v. kenaiensis Merriam, 1900 — Alaska (Kenai Peninsula). V. v. kurdistanica Satunin, 1906 — Armenia and NE Turkey. V. v. macroura Baird, 1852 — USA (Mountain States). V. v. montana Pearson, 1836 — Himalayas form China (Yunnan) to C Pakistan. V. v. mecator Merriam, 1900 — SW USA (California & Nevada). V_ v. ochroxantha Ognev, 1926 — E Russian Turkestan, Aksai, Kirgizstan, Semirechie. V. v. palaestina Thomas, 1920 —Jordan and Lebanon. V.v. peculiosa Kishida, 1924 — Korea. V. v. pusilla Blyth, 1854 — NW India to Irak. V.v. regalis Merriam, 1900 — N Great Plains of Canada and USA. V. v. rubricosa Bangs, 1898 — E Canada. V.v. schrencki Kishida, 1924 — N Japan (Hokkaido) and NE Russia (Sakhalin). V. v. silacea G. S. Miller, 1907 — Iberian Peninsula. V.v. splendidissima Kishida, 1924 — E Russia (N & C Kurile Is). V. v. stepensis Brauner, 1914 — steppes of S Russia. V. v. tobolica Ognev, 1926 — Russia (lower basin of Ob River) V. v. tschiliensis Matschie, 1907 — NE China. Foxes of European origin were introduced into E USA and Canada in the 17" century, subsequently mixed with local subspecies. Also introduced to Australia in 1800s, and the Falkland Islands (Malvinas).
Distribution. Endemic to the Indian subcontinent. Ranges from the foothills of the Himalayas in Nepal to the S tip of the Indian peninsula, also in Bangladesh and Pakistan. in Canidae
Distribution. Endemic to the Indian subcontinent. Ranges from the foothills of the Himalayas in Nepal to the S tip of the Indian peninsula, also in Bangladesh and Pakistan.
Distribution. Widespread in the Tibetan Plateau from Ladakh in India, E across China including parts of the Xinjiang, Gansu, Qinghai, and Sichuan provinces and all of the Xizang. In Nepal, N of the Himalaya, especially in the Mustang area. in Canidae
Distribution. Widespread in the Tibetan Plateau from Ladakh in India, E across China including parts of the Xinjiang, Gansu, Qinghai, and Sichuan provinces and all of the Xizang. In Nepal, N of the Himalaya, especially in the Mustang area.
Subspecies and Distribution. A. f. fulgens Cuvier, 1825 — E Himalayas in Bhutan, India, Nepal, Sikkim; China (S & SE Xizang & NW Yunnan), NE India (Meghalaya), and N Myanmar. A. f. styani Thomas, 1902 — China (W Sichuan & N Yunnan). in Ailuridae
Subspecies and Distribution. A. f. fulgens Cuvier, 1825 — E Himalayas in Bhutan, India, Nepal, Sikkim; China (S & SE Xizang & NW Yunnan), NE India (Meghalaya), and N Myanmar. A. f. styani Thomas, 1902 — China (W Sichuan & N Yunnan).
FIGURES 21–24 in Three new species of the genus Aemene Walker (Lepidoptera: Erebidae: Arctiinae) from the Himalayas
FIGURES 21–24. Aemene spp.: male genitalia. Depositories of the specimens dissected: 21 in CKC; 22–24 in MWM/ZSM.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.