Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

1,334

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

1,334 results for “Himalayas”

Learn how ShareScore rates datasets ↗
zenodo32/100

FIGURES 30–36 in A new whitefly genus and species, Himalayaleyrodes sarcococcae Dubey (Hemiptera: Aleyrodidae) infesting Christmas box (Buxaceae) in Western Himalaya, India

FIGURES 30–36. Himalayaleyrodes sarcococcae Dubey sp. nov., SEM photomicrographs, puparium and adult male, 30, puparium, ventral view; 31, caudal tracheal fold, stipples; 32, microseta at leg base; 33, thoracic legs; 34, thoracic tracheal fold; 35, spiracle, stipples; 36, adult male genitalia.

opennotspecifiedDec 2017View details →
zenodo32/100

FIGURES 23–29 in A new whitefly genus and species, Himalayaleyrodes sarcococcae Dubey (Hemiptera: Aleyrodidae) infesting Christmas box (Buxaceae) in Western Himalaya, India

FIGURES 23–29. Himalayaleyrodes sarcococcae Dubey sp. nov., SEM photomicrographs, puparium, 23, dorsal view; 24, marginal and submargin setae; 25, posterior abdominal area; 26, thoracic tracheal pore area; 27, geminate pore; 28, subdorsal band of wax gland, simple pores on band; 29, vasiform orifice.

opennotspecifiedDec 2017View details →
zenodo32/100

Data for: Light-absorbing impurities in glacial environments over western Himalaya from reanalysis data and in situ observations

<p>The repository contains information about 6 aerosol variables extracted from MERRA-2 reanalysis over western Himalayan region of Jammu and Kashmir. It also contains data about glacier ice chemistry based on 9 physicochemical characteristics of 3 glaciers nestled in the Greater Himalayan Mountain range of Kashmir. Air mass back trajectories as simulated from HYSPLIT model on a seasonal basis are also provided.</p>

opencc-by-4.0Dec 2023View details →
zenodo32/100

FIGURE 6 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)

FIGURE 6. Male genitalia of Cinygmula longissima sp. nov. A: genitalia (dorsal view); B: genitalia (ventral view); C: penes (dorsal view); D: penes (ventral view); E: titillators of penes; F: lateral spine

opennotspecifiedFeb 2024View details →
zenodo32/100

FIGURE 4 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)

FIGURE 4. Male imago of Cinygmula longissima sp. nov. A: habitus; B: legs (fore–, mid– and hindlegs from left to right and foreclaws enlarged); C: head (dorsal view); D: head (lateral view)

opennotspecifiedFeb 2024View details →
zenodo32/100

FIGURE 3 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)

FIGURE 3. Nymphal mouthparts of Cinygmula longissima sp. nov. A: labrum (dorsal view); B: left mandible (dorsal view); C: right mandible (dorsal view); D. hypopharynx (dorsal view); E: left maxilla (ventral view); F: labium (ventral view)

opennotspecifiedFeb 2024View details →
zenodo32/100

FIGURE 2 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)

FIGURE 2. Nymphal structures of Cinygmula longissima sp. nov. A: head of a mature nymph (showing the frontal fold in the shell, dorsal view); B: head capsule (showing the shape, dorsal view); C: fore–, mid– and hindleg (from above to bottom); D. Gills I–VII (from left to right)

opennotspecifiedFeb 2024View details →
zenodo32/100

Figs 3–9 in Review of the genus Chrysolina Motschulsky, 1860 (Coleoptera: Chrysomelidae) from Nepal Himalaya with description of a new species

Figs 3–9. Chrysolina, aedeagus structure: 3–7 — Ch. romandudkoi sp.n.; 8–9 — Ch. nagaja (Daccordi, 1982) from Solukhumbu Distr., env. Lamjura La Pass; 3, 8 — lateral view, 4, 6, 9 — dorsal view (4 — holotype), 5 — ventral view, 7 — view of the apex and apical orifice along the main axis (paratype). Scale bar — 1mm. Рис. 3–9. Chrysolina, строение Эдеагуса: 3–7 — Ch. romandudkoi sp.n.; 8–9 — Ch. nagaja (Daccordi, 1982) иЗ района Solukhumbu, окрестностей перевала Lamjura La; 3, 8 —сбоку, 4, 6, 9 —сверху (4 — голотип); 5 —сниЗу; 7 —верШина и апикальное отверстие вдоль продольной оси (паратип). МасШтаб — 1мм.

opennotspecifiedSep 2019View details →
zenodo32/100

Figs 1–2. Chrysolina tangalaensis Kimoto, 2001 in Review of the genus Chrysolina Motschulsky, 1860 (Coleoptera: Chrysomelidae) from Nepal Himalaya with description of a new species

Figs 1–2. Chrysolina tangalaensis Kimoto, 2001, male, holotype, general dorsal and lateral view. Photo by Dr. Ako Tachi (Kyushu University, Fukuoka, Japan). Рис. 1–2. Chrysolina tangalaensis Kimoto, 2001, самец, голотип, обЩий вид сверху и сбоку. Фото д-ра Ако Тачи (Университет Кюсю, Фукуока, ЯпониЯ).

opennotspecifiedSep 2019View details →
zenodo32/100

Figs 18–21 in Review of the genus Chrysolina Motschulsky, 1860 (Coleoptera: Chrysomelidae) from Nepal Himalaya with description of a new species

Figs 18–21. Chrysolina, general dorsal view: 18 — Ch. nagaja (Daccordi, 1982) from env. Lamjura La Pass; 19–21 — Ch. romandudkoi sp.n., paratypes (19–20 — males, 21 — female). Scale bar — 1mm. Рис. 18–21. Chrysolina, обЩий вид сверху: 18 — Ch. nagaja (Daccordi, 1982) иЗ окрестностей перевала Lamjura La; 19–21 — Ch. romandudkoi sp.n., паратипы (19–20 — самцы, 21 — самка). МасШтаб — 1мм.

opennotspecifiedSep 2019View details →
zenodo32/100

Figs 10–17 in Review of the genus Chrysolina Motschulsky, 1860 (Coleoptera: Chrysomelidae) from Nepal Himalaya with description of a new species

Figs 10–17. Chrysolina, aedeagus: 10–11 — Ch. daccordii (L. Medvedev et Sprecher-Uebersax, 1999); 12–13 — Ch. hartmanni Medvedev, 1999; 14–15 — Ch. dhaulagirica dhaulagirica Medvedev, 1990; 16–17 — Ch. dhaulagirica arunensis Medvedev, 1992; 10, 12, 14, 16 — lateral view; 11, 13, 15, 17 — dorsal view [10–11 — after Bienkowski, 2013; 12–13 — after Medvedev, 1999; 14–15 — after Medvedev, 1990; 16–17 — after Medvedev, 1992, slightly modified]. Рис. 10–17. Chrysolina, Эдеагус сбоку и сверху: 10–11 — Ch. daccordii (L. Medvedev et Sprecher-Uebersax, 1999); 12–13 — Ch. hartmanni Medvedev, 1999; 14–15 — Ch. dhaulagirica dhaulagirica Medvedev, 1990; 16–17 — Ch. dhaulagirica arunensis Medvedev, 1992; 10, 12, 14, 16 — сбоку; 11, 13, 15, 17 — сверху [10–11 — по Bienkowski, 2013; 12–13 — по Medvedev, 1999; 14–15 — по Medvedev, 1990; 16–17 — по Medvedev, 1992, с небольШими иЗменениЯми].

opennotspecifiedSep 2019View details →
zenodo32/100

Table 1 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species

<p><b>Table 1.</b> Primers used for PCR and sequencing</p><table><tbody><tr><th>Locus</th><th>Primer name</th><th>Primer sequences</th><th>Sense/anti-sense</th><th>Reference</th></tr></tbody><tbody><tr><th><i>CYT B</i></th><td>L14724_hk3</td><td>GGACTTATGACATGAAAAATCATCGTTG</td><td>Sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><td>H15915_hk3</td><td>GATTCCCCATTTCTGGTTTACAAGAC</td><td>Anti-sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><th>12S</th><td>L613_hk1</td><td>GGCGGGCGAGCAAAGCACTGAAAATG</td><td>Sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><td>H1478_hk1</td><td>TGATTGGTGGAGGGTGACGAGCGGTGTGT</td><td>Anti-sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><th><i>BRCA1</i></th><td>B1f</td><td>TGAGAACAGCACTTTATTACTCAC</td><td>Sense</td><td>Dubey <i>et al.</i>, 2006</td></tr><tr><td>B1r</td><td>ATTCTAGTTCCATATTGCTTATACTG</td><td>Anti-sense</td><td>Dubey <i>et al.</i>, 2006</td></tr><tr><th><i>APOB</i></th><td>ApoBf</td><td>GCAATCATTTGACTTAAGTG</td><td>Sense</td><td>Dubey <i>et al.</i>, 2007</td></tr><tr><td>ApoBr</td><td>GAGCAACAATATCTGATTGG</td><td>Anti-sense</td><td>Dubey <i>et al.</i>, 2007</td></tr><tr><th><i>RAG2</i></th><td>RAG2-F220</td><td>GATTCCTGCTAYCTYCCTCCTCT</td><td>Sense</td><td>Teeling <i>et al.</i>, 2000</td></tr><tr><td>RAG2-R995</td><td>CCCATGTTGCTTCCAAACCATA</td><td>Anti-sense</td><td>Teeling <i>et al.</i>, 2000</td></tr></tbody></table>

opennotspecifiedJan 2021View details →
zenodo32/100

In situ characterization of dust storms and their snow darkening effect over Himalayas

<p>The dataset provided here pertains to the Mukteshwar region. Users are requested to acknowledge the data curators before utilizing it.</p>

opencc-by-4.0Dec 2024View details →
zenodo32/100

Figure 2 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species

Figure 2. Dorsal, ventral and lateral views of the skull and lateral views of the mandible of the holotype of Alpiscaptulus medogensis (KIZ: 037966; left) and Scapanulus oweni (KIZ: 033872; right). Scale bar = 10 mm.

opennotspecifiedJan 2021View details →
zenodo32/100

Figure 5 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species

Figure 5. Results of maximum likelihood phylogenetic analyses of concatenated (A) mitochondrial genes, (B) nuclear genes and (C) mitochondrial-nuclear trees. Node numbers indicate Bayesian posterior probabilities (PP) and ultrafast bootstrap supports (UFBoot). Branch lengths represent substitutions per site.

opennotspecifiedJan 2021View details →
zenodo32/100

Subspecies and Distribution. V. v. vulpes Linnaeus, 1758 — N Europe (Scandinavia). V. v. abietorum Merriam, 1900 — SW Canada (Alberta & British Columbia). V. v. aegyptiacus Sonnini, 1816 — Egypt, Israel, and Lybia. V. v. alascensis Merriam, 1900 — Alaska and NW Canada (NW Territories & Yukon). V. v. alpheraky: Satunin, 1906 — Kazakhstan. V. v. anatolica Thomas, 1920 — Turkey. V. v. arabica Thomas, 1902 — Arabian peninsula. V. v. atlantica Wagner, 1841 — Algeria (forested Atlas Mts). V. v. bangsi Merriam, 1900 — NE Canada (Labrador). V. v. barbara Shaw, 1800 — NW Africa (Barbary Coast). V. v. beringiana Middendorff, 1875 — NE Siberia (shore of Bering Strait). V. v. cascadensis Merriam, 1900 — NW USA (Cascade Mountains, Oregon & Washington). V. v. caucasica Dinnik, 1914 — SW Russia (Caucasus). V. v. crucigera Bechstein, 1789 — Europe through N & C Russia. V. v. daurica Ognev, 1931 — E Russia (Amur, Siberia & Transbaikalia). V.v. deletrix Bangs, 1898 — NE Canada (Newfoundland). V. v. dolichocrania Ognev, 1926 — SE Siberia (S Ussuri). V. v. flavescens Gray, 1843 — N Iran. V. v. fulva Desmarest, 1820 — E USA. V. v. griffith: Blyth, 1854 — Afghanistan and N Pakistan. V.v. harrimani Merriam, 1900 — Alaska (Kodiak I). V. v. hoole Swinhoe, 1870 — S China (Fujian to Sichuan). V. v. ichnusae G. S. Miller, 1907 — Corsica and Sardinia. V. v. induta G. S. Miller, 1907 — Cyprus. V. v. jakutensis Ognev, 1923 — E Siberia (S of Yakutsk). V. v. japonica Gray, 1868 — Japan. V. v. karagan Erxleben, 1777 — Mongolia, Kazakhstan, and Kirgizstan. V. v. kenaiensis Merriam, 1900 — Alaska (Kenai Peninsula). V. v. kurdistanica Satunin, 1906 — Armenia and NE Turkey. V. v. macroura Baird, 1852 — USA (Mountain States). V. v. montana Pearson, 1836 — Himalayas form China (Yunnan) to C Pakistan. V. v. mecator Merriam, 1900 — SW USA (California & Nevada). V_ v. ochroxantha Ognev, 1926 — E Russian Turkestan, Aksai, Kirgizstan, Semirechie. V. v. palaestina Thomas, 1920 —Jordan and Lebanon. V.v. peculiosa Kishida, 1924 — Korea. V. v. pusilla Blyth, 1854 — NW India to Irak. V.v. regalis Merriam, 1900 — N Great Plains of Canada and USA. V. v. rubricosa Bangs, 1898 — E Canada. V.v. schrencki Kishida, 1924 — N Japan (Hokkaido) and NE Russia (Sakhalin). V. v. silacea G. S. Miller, 1907 — Iberian Peninsula. V.v. splendidissima Kishida, 1924 — E Russia (N & C Kurile Is). V. v. stepensis Brauner, 1914 — steppes of S Russia. V. v. tobolica Ognev, 1926 — Russia (lower basin of Ob River) V. v. tschiliensis Matschie, 1907 — NE China. Foxes of European origin were introduced into E USA and Canada in the 17" century, subsequently mixed with local subspecies. Also introduced to Australia in 1800s, and the Falkland Islands (Malvinas). in Canidae

Subspecies and Distribution. V. v. vulpes Linnaeus, 1758 — N Europe (Scandinavia). V. v. abietorum Merriam, 1900 — SW Canada (Alberta &amp; British Columbia). V. v. aegyptiacus Sonnini, 1816 — Egypt, Israel, and Lybia. V. v. alascensis Merriam, 1900 — Alaska and NW Canada (NW Territories &amp; Yukon). V. v. alpheraky: Satunin, 1906 — Kazakhstan. V. v. anatolica Thomas, 1920 — Turkey. V. v. arabica Thomas, 1902 — Arabian peninsula. V. v. atlantica Wagner, 1841 — Algeria (forested Atlas Mts). V. v. bangsi Merriam, 1900 — NE Canada (Labrador). V. v. barbara Shaw, 1800 — NW Africa (Barbary Coast). V. v. beringiana Middendorff, 1875 — NE Siberia (shore of Bering Strait). V. v. cascadensis Merriam, 1900 — NW USA (Cascade Mountains, Oregon &amp; Washington). V. v. caucasica Dinnik, 1914 — SW Russia (Caucasus). V. v. crucigera Bechstein, 1789 — Europe through N &amp; C Russia. V. v. daurica Ognev, 1931 — E Russia (Amur, Siberia &amp; Transbaikalia). V.v. deletrix Bangs, 1898 — NE Canada (Newfoundland). V. v. dolichocrania Ognev, 1926 — SE Siberia (S Ussuri). V. v. flavescens Gray, 1843 — N Iran. V. v. fulva Desmarest, 1820 — E USA. V. v. griffith: Blyth, 1854 — Afghanistan and N Pakistan. V.v. harrimani Merriam, 1900 — Alaska (Kodiak I). V. v. hoole Swinhoe, 1870 — S China (Fujian to Sichuan). V. v. ichnusae G. S. Miller, 1907 — Corsica and Sardinia. V. v. induta G. S. Miller, 1907 — Cyprus. V. v. jakutensis Ognev, 1923 — E Siberia (S of Yakutsk). V. v. japonica Gray, 1868 — Japan. V. v. karagan Erxleben, 1777 — Mongolia, Kazakhstan, and Kirgizstan. V. v. kenaiensis Merriam, 1900 — Alaska (Kenai Peninsula). V. v. kurdistanica Satunin, 1906 — Armenia and NE Turkey. V. v. macroura Baird, 1852 — USA (Mountain States). V. v. montana Pearson, 1836 — Himalayas form China (Yunnan) to C Pakistan. V. v. mecator Merriam, 1900 — SW USA (California &amp; Nevada). V_ v. ochroxantha Ognev, 1926 — E Russian Turkestan, Aksai, Kirgizstan, Semirechie. V. v. palaestina Thomas, 1920 —Jordan and Lebanon. V.v. peculiosa Kishida, 1924 — Korea. V. v. pusilla Blyth, 1854 — NW India to Irak. V.v. regalis Merriam, 1900 — N Great Plains of Canada and USA. V. v. rubricosa Bangs, 1898 — E Canada. V.v. schrencki Kishida, 1924 — N Japan (Hokkaido) and NE Russia (Sakhalin). V. v. silacea G. S. Miller, 1907 — Iberian Peninsula. V.v. splendidissima Kishida, 1924 — E Russia (N &amp; C Kurile Is). V. v. stepensis Brauner, 1914 — steppes of S Russia. V. v. tobolica Ognev, 1926 — Russia (lower basin of Ob River) V. v. tschiliensis Matschie, 1907 — NE China. Foxes of European origin were introduced into E USA and Canada in the 17" century, subsequently mixed with local subspecies. Also introduced to Australia in 1800s, and the Falkland Islands (Malvinas).

opennotspecifiedJan 2009View details →
zenodo32/100

Distribution. Endemic to the Indian subcontinent. Ranges from the foothills of the Himalayas in Nepal to the S tip of the Indian peninsula, also in Bangladesh and Pakistan. in Canidae

Distribution. Endemic to the Indian subcontinent. Ranges from the foothills of the Himalayas in Nepal to the S tip of the Indian peninsula, also in Bangladesh and Pakistan.

opennotspecifiedJan 2009View details →
zenodo32/100

Distribution. Widespread in the Tibetan Plateau from Ladakh in India, E across China including parts of the Xinjiang, Gansu, Qinghai, and Sichuan provinces and all of the Xizang. In Nepal, N of the Himalaya, especially in the Mustang area. in Canidae

Distribution. Widespread in the Tibetan Plateau from Ladakh in India, E across China including parts of the Xinjiang, Gansu, Qinghai, and Sichuan provinces and all of the Xizang. In Nepal, N of the Himalaya, especially in the Mustang area.

opennotspecifiedJan 2009View details →
zenodo32/100

Subspecies and Distribution. A. f. fulgens Cuvier, 1825 — E Himalayas in Bhutan, India, Nepal, Sikkim; China (S & SE Xizang & NW Yunnan), NE India (Meghalaya), and N Myanmar. A. f. styani Thomas, 1902 — China (W Sichuan & N Yunnan). in Ailuridae

Subspecies and Distribution. A. f. fulgens Cuvier, 1825 — E Himalayas in Bhutan, India, Nepal, Sikkim; China (S &amp; SE Xizang &amp; NW Yunnan), NE India (Meghalaya), and N Myanmar. A. f. styani Thomas, 1902 — China (W Sichuan &amp; N Yunnan).

opennotspecifiedJan 2009View details →
zenodo32/100

FIGURES 21–24 in Three new species of the genus Aemene Walker (Lepidoptera: Erebidae: Arctiinae) from the Himalayas

FIGURES 21–24. Aemene spp.: male genitalia. Depositories of the specimens dissected: 21 in CKC; 22–24 in MWM/ZSM.

opennotspecifiedNov 2021View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record