Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
688
datasets available to search
ShareScore release 0.9.0
Dataset results
688 results for “Arabian Peninsula”
Figure 31 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 31 – Brandberg Mt. on the edge of the Namib Desert, Namibia, view from north-east. Locality of H. albida. (photo: Mey)
Figure 33 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 33 – Bvumba Mts., Zimbabwe, locality of H. calamitosa, H. ravula, H. taraktica sp. nov., and H. watamomaritima (photo: D. Agassiz)
Figure 30 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 30 – Female genitalia of Homadaula spec. B, a - lateral aspect, b – dorsal side of tergum VII and VIII, c – ventral side, scale bar: 0.5 mm.
Figure 26 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 26 – Male genitalia of Homadaula taraktica sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.
Figure 24 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 24 – Female genitalia of Homadaula saharaensis sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.
Figure 11 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 11 – Female genitalia of Homadaula deprinsorum sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.
Figure 13 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 13 – Male genitalia of Homadaula gabonensis sp. nov., a – lateral, b – ventral, c –dorsal, scale bar: 0.5 mm.
Figure 27 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 27 – Female genitalia of Homadaula taraktica sp. nov., a – lateral, b – dorsal side of tergum VII.
Figure 10 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 10 – Male genitalia of Homadaula deprinsorum sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.
Figure 15 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 15 – Male genitalia of Homadaula larseni sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.
Figure 6 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 6 – Male genitalia of Homadaula agassizi sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.
Figure 8 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 8 – Female genitalia of Homadaula arabica sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.
Figure 18 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 18 – Male genitalia of Homadaula malawiensis sp. nov., a – lateral, b – ventral, c – dorsal, scale bar: 0.5 mm.
Figure 1 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 1 – Homadaula calamitosa Meyrick, 1930, female genitalia, a – lateral view, b -tergum VII, dorsal aspect¸ scale bar: 0.4 mm.
Figure 23 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 23 – Male genitalia of Homadaula saharaensis sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.
Figure 2 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 2 – Homadaula watamomaritima Mey, 2005, female genitalia, a – lateral view, b -tergum VII and VIII, dorsal aspect, c – ventral aspect, scale bar: 0.5 mm.
Figure 21 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)
Figure 21 – Male genitalia of Homadaula peregovitsi sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.
Table 1 in DNA barcoding of the genus Verbascum (Scrophulariaceae) in the Arabian Peninsula
<p><b>Table 1.</b> PCR Primers used for amplification in DNA regions.</p><table><tbody><tr><th>Region</th><th>Primer</th><th>Sequence (5′–3′)</th><th>Reference</th></tr></tbody><tbody><tr><th><i>rbcL</i></th><td>rbcLa-F rbcLa-R</td><td>ATGTCACCACAAACAGAGACTAAAGC GTAAAATCAAGTCCACCRCG</td><td>Levin & al. (2003)</td></tr><tr><th><i>matK</i></th><td>matK472F matK1248R</td><td>CCCRTYCATCTGGAAATCTTGGTTC GCTRTRATAATGAGAAAGATTTCTGC</td><td>Yu & al. (2011)</td></tr><tr><th><i>trnL</i></th><td>trnL-f trnL-c</td><td>ATTTGAACTGGTGACACGAG CGAAATCGGTAGACGCTACG</td><td>Taberlet & al. (1991)</td></tr><tr><th>ITS</th><td>ITS2F ITS3R</td><td>ATGCGATACTTGGTGTGAAT GACGCTTCTCCAGACTACAAT</td><td>Chen & al. (2010)</td></tr></tbody></table>
Data for: "High-resolution Soil Moisture Evolution in Hyper-arid Regions: A Comparison of InSAR, SAR, Microwave, Optical, and Data Assimilation Systems in the southern Arabian Peninsula"
<p>Data accompanying the publication: High-resolution Soil Moisture Evolution in Hyper-arid Regions: A Comparison of InSAR, SAR, Microwave, Optical, and Data Assimilation Systems in the southern Arabian Peninsula. For filenames starting with T: Exponential fit parameters time0 and mag0 for InSAR coherence data. they are binary files, where fit = a*exp(-b*x); a = -log(mag0); b = 1/time0. timeerr contains the uncertainty of the time0 parameter, and maghigh/maglow contain the high and low uncertainty for the mag0 parameter, respectively. For for each frame or overlap region (T101, T28, T130, T28_T101, T130_T28), there is a vrt file (T..._20180524.time0.vrt), which is the metadata file applicable to all files of the same frame. Files starting with mags_times: Exponential fit parameters for ASCAT/SMAP/GLDAS data. the same parameters (time0, timeerr, mag0, maghigh, maglow) can be found in these matlab structure files. In addition, the .mat files contain the offset parameter and related uncertainty, as well as lat/lon information. </p>
Figure 98 in A review of the genus Leiurus Ehrenberg, 1828 (Scorpiones: Buthidae) with description of four new species from the Arabian Peninsula
Figure 98: Selected morphometrics of Leiurus, Cicileiurus, Cicileus and Compsobuthus compared to other Buthus group scorpions. A–B. Scatter plots of the fraction of fixed finger length distal to db (A) and est (B) vs. the ratio of movable finger length to carapace length. Each point represents one sex of one species. Larger ordinate values correspond to more basal positions of the trichobothria, and larger abscissa values to longer pedipalp fingers. There was a significant inverse correlation between relative length of the portion of the fixed finger distal to db and est (R = -0.6534, -0.5488, respectively), and the relative length of the movable finger (the latter being a measure of elongation of both fixed and movable fingers). Highlighted symbols show that Leiurus (light magenta circles), Cicileiurus (red triangle), Cicileus (green squares) and Compsobuthus (yellow circles) are located in the lower right halves of the plots, i.e. all have relatively elongated fingers and more distal placement of both db and est. Gray circles are data from other Buthus group species. C. Scatter plot of the fraction of fixed finger length distal to db vs. the fraction distal to est. The strong positive correlation (R = 0.8052) indicates a tendency for db and est to move together towards more distal locations as the fixed finger becomes more elongated. Species above the diagonal (solid blue) have db proximal to est, and those below have db distal to est. Solid gray lines in A–C are fits by least squares regression through all points. D. Scatter plot of pedipalp femur L/W (a measure of pedipalp elongation) vs. carapace L (a measure of body size). These two variables were not significantly correlated (R = 0.094). Data were compiled from the literature and specimens in the authors collections for 38 genera and 203 species representing the majority of taxa in the Buthus group, including both males (N = 124) and females (N = 97). Genera (and number of species) included: Afghanobuthus (1), Androctonus (11), Apistobuthus (2), Baloorthochirus (1), Birulatus (2), Buthacus (13), Butheoloides (11), Butheolus (5), Buthiscus (1), Buthus (26), Cicileiurus (1), Cicileus (2), Compsobuthus (33), Congobuthus (1), Darchenia (1), Gint (1), Hemibuthus (1), Hottentotta (31), Leiurus (10), Liobuthus (1), Lissothus (3), Mesobuthus (7), Neobuthus (2), Odontobuthus (6), Orthochirus (12), Pantobuthus (1), Pectinibuthus (1), Plesiobuthus (1), Polisius (1), Razianus (3), Saharobuthus (1), Somalibuthus (1), Vachoniolus (4), Vachonus (1).
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.