Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

688

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

688 results for “Arabian Peninsula”

Learn how ShareScore rates datasets ↗
zenodo40/100

Figure 31 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 31 – Brandberg Mt. on the edge of the Namib Desert, Namibia, view from north-east. Locality of H. albida. (photo: Mey)

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 33 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 33 – Bvumba Mts., Zimbabwe, locality of H. calamitosa, H. ravula, H. taraktica sp. nov., and H. watamomaritima (photo: D. Agassiz)

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 30 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 30 – Female genitalia of Homadaula spec. B, a - lateral aspect, b – dorsal side of tergum VII and VIII, c – ventral side, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 26 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 26 – Male genitalia of Homadaula taraktica sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 24 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 24 – Female genitalia of Homadaula saharaensis sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 11 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 11 – Female genitalia of Homadaula deprinsorum sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 13 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 13 – Male genitalia of Homadaula gabonensis sp. nov., a – lateral, b – ventral, c –dorsal, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 27 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 27 – Female genitalia of Homadaula taraktica sp. nov., a – lateral, b – dorsal side of tergum VII.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 10 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 10 – Male genitalia of Homadaula deprinsorum sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 15 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 15 – Male genitalia of Homadaula larseni sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 6 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 6 – Male genitalia of Homadaula agassizi sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 8 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 8 – Female genitalia of Homadaula arabica sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 18 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 18 – Male genitalia of Homadaula malawiensis sp. nov., a – lateral, b – ventral, c – dorsal, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 1 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 1 – Homadaula calamitosa Meyrick, 1930, female genitalia, a – lateral view, b -tergum VII, dorsal aspect¸ scale bar: 0.4 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 23 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 23 – Male genitalia of Homadaula saharaensis sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 2 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 2 – Homadaula watamomaritima Mey, 2005, female genitalia, a – lateral view, b -tergum VII and VIII, dorsal aspect, c – ventral aspect, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Figure 21 in Unexpected diversity: ten new species of Homadaula Lower, 1899 from Africa and the Arabian Peninsula (Galacticoidea: Galacticidae)

Figure 21 – Male genitalia of Homadaula peregovitsi sp. nov., a – lateral, b – dorsal, c – ventral, scale bar: 0.5 mm.

opencc-by-4.0Apr 2022View details →
zenodo40/100

Table 1 in DNA barcoding of the genus Verbascum (Scrophulariaceae) in the Arabian Peninsula

<p><b>Table 1.</b> PCR Primers used for amplification in DNA regions.</p><table><tbody><tr><th>Region</th><th>Primer</th><th>Sequence (5&prime;&ndash;3&prime;)</th><th>Reference</th></tr></tbody><tbody><tr><th><i>rbcL</i></th><td>rbcLa-F rbcLa-R</td><td>ATGTCACCACAAACAGAGACTAAAGC GTAAAATCAAGTCCACCRCG</td><td>Levin &amp; al. (2003)</td></tr><tr><th><i>matK</i></th><td>matK472F matK1248R</td><td>CCCRTYCATCTGGAAATCTTGGTTC GCTRTRATAATGAGAAAGATTTCTGC</td><td>Yu &amp; al. (2011)</td></tr><tr><th><i>trnL</i></th><td>trnL-f trnL-c</td><td>ATTTGAACTGGTGACACGAG CGAAATCGGTAGACGCTACG</td><td>Taberlet &amp; al. (1991)</td></tr><tr><th>ITS</th><td>ITS2F ITS3R</td><td>ATGCGATACTTGGTGTGAAT GACGCTTCTCCAGACTACAAT</td><td>Chen &amp; al. (2010)</td></tr></tbody></table>

opencc-by-4.0Apr 2024View details →
zenodo40/100

Data for: "High-resolution Soil Moisture Evolution in Hyper-arid Regions: A Comparison of InSAR, SAR, Microwave, Optical, and Data Assimilation Systems in the southern Arabian Peninsula"

<p>Data accompanying the publication:&nbsp;High-resolution Soil Moisture Evolution in Hyper-arid Regions: A Comparison of InSAR, SAR, Microwave, Optical, and Data Assimilation Systems in the southern Arabian Peninsula. For filenames starting with T: Exponential fit parameters time0 and mag0 for InSAR coherence data. they are binary files,&nbsp;where&nbsp;fit&nbsp;&nbsp;= a*exp(-b*x); a =&nbsp;-log(mag0); b = 1/time0. timeerr contains the uncertainty of the time0 parameter, and maghigh/maglow contain the high and low uncertainty for the mag0 parameter, respectively.&nbsp; For for each frame or overlap region (T101, T28, T130, T28_T101, T130_T28), there is a vrt file (T..._20180524.time0.vrt), which is the metadata file applicable to all files of the same frame. Files starting with mags_times: Exponential fit parameters for ASCAT/SMAP/GLDAS data. the same parameters (time0, timeerr, mag0, maghigh, maglow) can be found in these matlab structure files. In addition, the .mat files&nbsp;contain&nbsp;the offset parameter and related uncertainty, as well as lat/lon information.&nbsp;&nbsp;</p>

opencc-by-4.0Oct 2021View details →
zenodo40/100

Figure 98 in A review of the genus Leiurus Ehrenberg, 1828 (Scorpiones: Buthidae) with description of four new species from the Arabian Peninsula

Figure 98: Selected morphometrics of Leiurus, Cicileiurus, Cicileus and Compsobuthus compared to other Buthus group scorpions. A–B. Scatter plots of the fraction of fixed finger length distal to db (A) and est (B) vs. the ratio of movable finger length to carapace length. Each point represents one sex of one species. Larger ordinate values correspond to more basal positions of the trichobothria, and larger abscissa values to longer pedipalp fingers. There was a significant inverse correlation between relative length of the portion of the fixed finger distal to db and est (R = -0.6534, -0.5488, respectively), and the relative length of the movable finger (the latter being a measure of elongation of both fixed and movable fingers). Highlighted symbols show that Leiurus (light magenta circles), Cicileiurus (red triangle), Cicileus (green squares) and Compsobuthus (yellow circles) are located in the lower right halves of the plots, i.e. all have relatively elongated fingers and more distal placement of both db and est. Gray circles are data from other Buthus group species. C. Scatter plot of the fraction of fixed finger length distal to db vs. the fraction distal to est. The strong positive correlation (R = 0.8052) indicates a tendency for db and est to move together towards more distal locations as the fixed finger becomes more elongated. Species above the diagonal (solid blue) have db proximal to est, and those below have db distal to est. Solid gray lines in A–C are fits by least squares regression through all points. D. Scatter plot of pedipalp femur L/W (a measure of pedipalp elongation) vs. carapace L (a measure of body size). These two variables were not significantly correlated (R = 0.094). Data were compiled from the literature and specimens in the authors collections for 38 genera and 203 species representing the majority of taxa in the Buthus group, including both males (N = 124) and females (N = 97). Genera (and number of species) included: Afghanobuthus (1), Androctonus (11), Apistobuthus (2), Baloorthochirus (1), Birulatus (2), Buthacus (13), Butheoloides (11), Butheolus (5), Buthiscus (1), Buthus (26), Cicileiurus (1), Cicileus (2), Compsobuthus (33), Congobuthus (1), Darchenia (1), Gint (1), Hemibuthus (1), Hottentotta (31), Leiurus (10), Liobuthus (1), Lissothus (3), Mesobuthus (7), Neobuthus (2), Odontobuthus (6), Orthochirus (12), Pantobuthus (1), Pectinibuthus (1), Plesiobuthus (1), Polisius (1), Razianus (3), Saharobuthus (1), Somalibuthus (1), Vachoniolus (4), Vachonus (1).

opencc-by-4.0Dec 2014View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record