Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

320

datasets available to search

ShareScore release 0.9.0

Dataset results

320 results for “Beans”

Learn how ShareScore rates datasets ↗

zenodo40/100

Figure 4. Xylosandrus compactus boring coffee berries around the blossom area. X. compactus boring a in First Report of Exploitation of Coffee Beans by Black Twig Borer (Xylosandrus Compactus) and Tropical Nut Borer (Hypothenemus obscurus) (Coleoptera; Curculionidae: Scolytinae) in Hawaii

Figure 4. Xylosandrus compactus boring coffee berries around the blossom area. X. compactus boring a coffee berry (A, left), hole made by X. compactus on the endosperm (B, right); galleries or immature stages were not found.

opencc-by-4.0Dec 2012View details →

zenodo40/100

Figure 2 in First Report of Exploitation of Coffee Beans by Black Twig Borer (Xylosandrus Compactus) and Tropical Nut Borer (Hypothenemus obscurus) (Coleoptera; Curculionidae: Scolytinae) in Hawaii

Figure 2. Gallery of Xylosandrus compactus in coffee branches. Xylosandrus compactus female adults (left) and immature stages (right).

opencc-by-4.0Dec 2012View details →

zenodo40/100

Figure 3 in First Report of Exploitation of Coffee Beans by Black Twig Borer (Xylosandrus Compactus) and Tropical Nut Borer (Hypothenemus obscurus) (Coleoptera; Curculionidae: Scolytinae) in Hawaii

Figure 3. Damage symptoms of X. compactus in coffee branches. First leaves turn light green (A, left), then the wilted leaves and bark beyond the affected area turn brown or black (B, right).

opencc-by-4.0Dec 2012View details →

zenodo40/100

Fig. 1 in Stable isotope analysis spills the beans about spatial variance in trophic structure in a fish host - parasite system from the Vaal River System, South Africa

Fig. 1. Map of the Vaal River showing the position of sampling sites (I: below Grootdraai Dam; II: Vaal Dam; III: below Vaal River Barrage; IV: Bloemhof Dam; V: below Vaalharts Weir; VI: Douglas Weir) along the Vaal River. The block (B) indicates the position of the Vaal River within South Africa and insert A indicates the position of South Africa shaded on the African continent.

opencc-by-4.0Aug 2020View details →

zenodo40/100

Fig. 1 in Comparison of Bemisia tabaci infestation, virus infection, and yield in conventional and transgenic Bean golden mosaic virus-resistant common bean elite lines

Fig. 1. Symptoms of virus infection on common bean plants under field situation: (A) Bean golden mosaic virus; (B) Cowpea mild mottle virus on old transgenic plants and (C) young transgenic plant; (D) symptoms of mixed infection caused by Bean golden mosaic virus and Cowpea mild mottle virus.

opencc-by-4.0Apr 2023View details →

zenodo40/100

Fig. 1 in Population development of bean weevils (Coleoptera: Chrysomelidae: Bruchinae) in landrace varieties of cowpeas and common beans

Fig. 1. Daily emergence (insects per dish) of (a) Callsobruchus maculatus and (b) Zabrotes subfasciatus observed in landrace varietes of cowpea and common bean, respectvely. The symbols represent the means of 4 replicates. Error bars represent the standard error. The equaton parameters are provided in Table 1.

opencc-by-4.0Jul 2020View details →

zenodo40/100

Fig. 2 in Population development of bean weevils (Coleoptera: Chrysomelidae: Bruchinae) in landrace varieties of cowpeas and common beans

Fig. 2. Means of the total emergence of adult insects of (a) Callosobruchus maculatus and (b) Zabrotes subfasciatus recorded in landrace varietes of cowpea and common bean, respectvely. Means under the same line are not significantly different, according to Tukey's test (P <0.05).

opencc-by-4.0Jul 2020View details →

zenodo40/100

Fig. 4 in Population development of bean weevils (Coleoptera: Chrysomelidae: Bruchinae) in landrace varieties of cowpeas and common beans

Fig. 4. Means of the percentage weight loss of (a) cowpea and (b) common bean. Means under the same line are not significantly different, according to Tukey's test (P <0.005).

opencc-by-4.0Jul 2020View details →

zenodo40/100

Supplementary data to the African Yam Bean Whole Genome Sequencing Project ENA Project_ID:PRJEB57813

The first chromosome-scale assembly of the African yam bean, Sphenostylis stenocarpa (Hochst. ex. A. Rich.) Harms, an original African tuberous legume producing both pods and protein-rich tubers. ENA Project_ID: PRJEB57813 Genome Assembly Accession: GCA_963425845

opencc-by-4.0Sep 2024View details →

zenodo40/100

Identifying the Fusarium species involved in foot rot disease of beans in the UK using a combined molecular and microbiological approach

Materials and methods Fungal isolation Isolates (113) were prepared from both soil and infected plant samples that were received from the Plant Clinic at the Processors and Growers Research Organisation (PGRO). The samples were from different regions of England, United Kingdom (Table 1). <a name="_Ref165642771"></a>Table 1: The locations and number of isolates obtained for infected faba bean and soil samples used in the study. * = includes soil isolates <table> <tbody> <tr> <td> Location </td> <td> Number of isolates obtained </td> <td> Month(s) </td> </tr> <tr> <td> PGRO experimental plots </td> <td> 29* (13 soil, 16 plant) </td> <td> November 2022 </td> </tr> <tr> <td> Cambridgeshire </td> <td> 2 </td> <td> June 2023 </td> </tr> <tr> <td> Oxfordshire </td> <td> 3 </td> <td> June-July 2023 </td> </tr> <tr> <td> Durham </td> <td> 3 </td> <td> July 2023 </td> </tr> <tr> <td> Shropshire </td> <td> 4 </td> <td> July and August2023 </td> </tr> <tr> <td> Lincolnshire </td> <td> 5 </td> <td> July and August 2023 </td> </tr> <tr> <td> Northumberland </td> <td> 5 </td> <td> July and August 2023 </td> </tr> <tr> <td> Staffordshire </td> <td> 4 </td> <td> July  and August 2023 </td> </tr> <tr> <td> Suffolk </td> <td> 4 </td> <td> July 2023 </td> </tr> <tr> <td> Leicestershire </td> <td> 2 </td> <td> July 2023 </td> </tr> <tr> <td> Essex </td> <td> 4 </td> <td> July 2023 </td> </tr> <tr> <td> Norfolk </td> <td> 34 </td> <td> August 2023 </td> </tr> <tr> <td> Yorkshire </td> <td> 6 </td> <td> September 2023 </td> </tr> <tr> <td> Hampshire </td> <td> 2 </td> <td> July 2023 </td> </tr> <tr> <td> Undisclosed PGRO locations </td> <td> 6 </td> <td> Undisclosed </td> </tr> </tbody> </table>   Infected plant samples were disinfected by placing pieces of infected stems/root in 10 % sodium hypochlorite solution for 5 min. The samples were rinsed twice using sterilised distilled water and placed on sterilised filter paper to be dried for 10 min at room temperature inside a laminar flow hood. The dried samples were moved to potato dextrose agar medium (PDA) inside 9 cm diameter plastic Petri dishes. Petri dishes were incubated at 22<a name="_Hlk134433128"></a> °C with 12 h fluorescent photoperiod, <a name="_Hlk165887610"></a>and light intensity of 20-25 µMol.m-2.s-1. Once colonies had formed, clonal isolates were prepared from the colonies as follows. Approximately 1 mm2 of the colony was collected using a flame-sterilised inoculation loop and was sequentially spread onto three Petri dishes containing 2 % water agar, to dilute the inoculum gradually. The Petri dishes were incubated for 24 h as described above. The third Petri dish for each isolate was examined under a stereoscope, and one separated hypha was transferred using a flame-sterilised scalpel to another Petri dish containing PDA medium, and incubated for seven days to provide a clonal isolate. The isolates were stored for future use using two methods, for routine or long-term storage. For routine storage (months), three discs of the PDA medium containing the clonal isolate were transferred to a 2 ml microcentrifuge tube containing 1 ml of sterilised distilled water, the tube sealed with parafilm and stored at -20 °C. For long-term storage (3-4 years) the clonal isolate was plated onto a Petri dish containing many pieces of 1 cm long sterilised filter paper on PDA medium, and the colony was allowed to grow for seven days to cover the filter paper. The pieces of filter paper were removed and placed inside an empty Petri dish and dried for seven days at room temperature. The filter paper pieces were then transferred to an empty 2 ml plastic microcentrifuge tube and stored at -20 °C. Koch`s postulates were confirmed for each of the isolates by re-isolation, inoculation, and identification.   Pathogenicity testing Pathogenicity testing was conducted using susceptible faba bean seedlings (cv. Lynx) grown in test tubes in a mixture of perlite/vermiculite. The growth media was prepared by adding one volume of vermiculite (the capacity of a 1000 ml plastic beaker) to one volume of perlite inside an autoclave bag; this was mixed to ensure equal distribution of each component, and 1 litre of distilled water was added. The autoclave bag was closed and autoclaved for 20 min at 121 °C, and the mixture was transferred to fill 2/3 of the test tubes (150 x 24 mm, 1.2 ml wall; borosilicate glass 150 x 24 mm, rimless, Appleton Woods Ltd), which were then sealed with cotton wool and aluminium foil, prior to being autoclaved. Seeds were soaked in sterilized distilled water overnight and placed in 10 % sodium hypochlorite for 5 min. The seeds were washed three times with sterilised distilled water and placed on sterilised filter paper until dry. The seeds were then transferred to 9 cm petri dishes containing 1.2 % Tap Water Agar (12 g agar in 1 l of tap water, autoclaved in a 2 l conical flask), where they were allowed to germinate for four days in the incubator at 24 °C before being transferred to test tubes containing the vermiculite/perlite mixture. Following transfer, the seedlings were allowed to grow for five to seven days until they were suitable for inoculation (4-5 cm root length). The seedlings were inoculated by placing a 10 mm block of PDA medium containing a ten-day old fungal culture against the stem base. A small piece of sterilised cotton was placed around the stem to ensure adequate moisture at the inoculation site. The inoculated seedlings were incubated at 24 °C, with a 12 h photoperiod and light intensity of 20-25 µMol.m-2.s-1. Disease severity was monitored daily from 5-6 days after inoculation. Root and stem infection were scored on days 15 and 25 using a 5-point scale (Figure 2): 0 = healthy roots, no discolouration. 1 = up to 20 % root or stem base discoloured. 2 = 20-40 % root or stem base discoloured. 3 = 40-60 % root or stem base discoloured. 4 = 60-80 % root or stem base discoloured, stunting of plant. 5 = total discoloration, dead plant. DNA extraction Clonal colonies were cultured on 50 ml of Potato Dextrose Broth (PDB) medium (FORMEDIUMTM) in a 250 ml flask and incubated for seven days on a rotary shaker (22 °C with 70 RPM). The mycelium for each isolate was harvested by transferring the contents of each flask into a 50 ml falcon tube and centrifuging at 5000 RPM for 10 min. The supernatant was discarded, and the mycelium pellet stored at -20 °C. Mycelium (1 ml) was transferred to a 2 ml safe-lock microcentrifuge tube. The tubes were covered with parafilm which was pierced to allow moisture to evaporate. Samples were freeze-dried (-45 °C, 0.133 mbar) for 48 h. Freeze-dried mycelium (15 mg) was transferred to a 2 ml safe lock microcentrifuge tube containing two carbon steel ball bearings (3 mm diameter, grade 1000, SimplyBearings). The mycelium was homogenised for 4 min using a TissueLyser (Retsch MM400; 30 RPS), after which 120 µl of TNES buffer was added and the samples were homogenised again as before. Total DNA was extracted from the samples following the BOMB-Bio nucleic acid tissue DNA extraction protocol (Oberacker et al., 2019). The samples were incubated at 55 °C overnight after adding 2 µl of proteinase K and 3 µl of RNAase A. Following incubation, 240 µl of GITC lysis buffer was added, mixed and samples incubated at room temperature for 5 min. Isopropanol (480 µl) was added and, following centrifugation (5000 RPM; 5 min), 650 µl was transferred to a new tube with 200 µl of 1X BOMB-Bio magnetic bead solution (1:50 carboxylated SeraMag Speed Beads magnetic beads in TE) and mixed. The solution was placed on a magnetic rack to hold the beads with DNA bound to them in place whilst the supernatant was removed. The beads with bound DNA were washed once with isopropanol (400 µl) and twice with 80 % ethanol (400 µl). The solution was removed from the magnet, beads were allowed to dry briefly and 70 µl of nuclease free water was added to elute the DNA. The beads were removed by placing the samples back on the magnetic rack and transferring the supernatant to a new tube. The extracted DNA concentration was estimated using a Qubit 4 and 1X dsDNA High Sensitivity (HS) Assay Kit (Invitrogen) according to the manufacturer’s instructions. Polymerase Chain Reaction (PCR) DNA was amplified using PCR with three sets of primers: Internal Transcribed Spacer (ITS) primers ITS1/ITS4 (Raja et al., 2017) and two sets of Translation Elongation Factor one α primers, 1018F/1620R and EF1/EF2 (O’Donnell et al., 1998; Raja et al., 2017). Prior to PCR, the template DNA concentration was adjusted to<a name="_Hlk133674492"></a> 5 ng/μl using molecular grade water. The PCR mix <a name="_Hlk133674557"></a>contained: 12.5 µl of 2x MyTaq Red Mix (Meridian Bioscience), 3 µl of template DNA, 1 µl of each primer (10 µM) and 7.5 µl of nuclease free water to a final volume of 25 µl. The cycling conditions and sequence of each primer are given in Table 2. The PCR products were separated alongside a 1 kbp ladder (GeneRuler 1 kb Plus DNA Ladder Thermo scientific SM1331) using gel electrophoresis in a 1 % agarose gel in TAE buffer stained with GelRed® nucleic acid stain (Sigma Aldrich). Gels were visualised with a UV transilluminator (BioRad) to confirm successful amplification. <a name="_Ref162427061"></a>Table 2: The ITS (ITS1 and ITS4) and TEF1α (1018F, 1620R, EF1 and EF2) primer sequences and PCR conditions. <table> <tbody> <tr> <td> Primer </td> <td> Sequence (5’-3’) </td> <td> Initial Melt </td> <td> Melt </td> <td> Anneal </td> <td> Extension </td> <td> Final extension </td> </tr> <tr> <td> ITS1: ITS4:  (Raja et al., 2017) </td> <td> CGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC </td> <td> 94 °C 5 min </td> <td> 94°C 30 sec </td> <td> 55 °C 1 min </td> <td> 72 °C 2 min </td> <td> 72 °C 7 min </td> </tr> <tr> <td> 35 cycles </td> </tr> <tr> <td> 1018F: 1620R: (O’Donnell et al., 1998; Raja et al., 2017) </td> <td> GAYTTCATCAAGAACATGAT GACGTTGAADCCRACRTTGTC </td> <td> 94 °C 5 min   </td> <td> 94 °C 30 sec </td> <td> Touch down 66-56 °C 1 min   </td> <td> 72 °C 1 min </td> <td> 72 °C 10 min </td> </tr> <tr> <td> 9 cycles </td> </tr> <tr> <td> 94 °C 30 sec </td> <td> 56 °C 1 min   </td> <td> 72 °C 1 min </td> </tr> <tr> <td> Remaining 26 cycles </td> </tr> <tr> <td> EF1: EF2: (O’Donnell et al., 1998) (Raja et al., 2017) </td> <td> ATGGGTAAGGARGACAAGAC GGARGTACCAGT SATCATGTT   </td> <td> 95 °C 2 min </td> <td> 95 °C 30 sec </td> <td> 54.1 °C 1 min </td> <td> 72 °C 1 min </td> <td> 72 °C 5 min </td> </tr> <tr> <td> 35 cycles </td> </tr> <tr> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> </tr> </tbody> </table>   Prior to sequencing, the PCR products were purified using solid-phase reversible immobilisation (SPRI) magnetic beads. To each PCR product, 1 X SPRI beads were added at a 1:2 ratio of PCR product to bead solution (50 µl PCR product to 100 µl SPRI beads) and the mixture incubated for 5 min at room temperature. The tubes were transferred to the magnetic plate for 5 min until the solution was clear, at which point the supernatant was discarded and the beads were washed twice with 80% ethanol for 60 s each time. Ethanol was removed and the beads held on the magnetic plate were allowed to dry for 5-10 min at room temperature. The tubes containing the dry beads were removed from the magnetic plate, and 50 µl of molecular grade nuclease free water was added to each tube, mixed and incubated for 5 min, allowing the DNA to elute. The tubes were placed back on the magnetic plate for 5 min until the solution was clear, at which point the supernatant was transferred to a new 1.5 ml microcentrifuge tube. Sanger sequencing was carried out using ITS1, ITS4 primers and EF1, EF2 primers. All sequencing was carried out by Eurofins Genomics. Following sequencing, the chromatograms obtained were trimmed and analysed using Geneious Prime (version 2023.0.4). First, low-quality bases (e.g., overlapping peaks) were trimmed from each end and the sequence upstream from that site, including the primer sequence, was deleted. The forward and reverse sequence for each sample were assembled using the de novo assemble function in Geneious at the highest sensitivity to create a consensus sequence (highest threshold quality: 60%). A basic local alignment search tool (BLAST) search was carried out for the consensus sequences using the NCBI-NR database for the ITS sequences, and, for the TEF1α sequences, the data available on the Fusarium ID database (Torres-Cruz et al., 2022). All of the TEF1α consensus sequences from all samples were subsequently aligned with the available sequences on the Fusarium ID database (Geneious global alignment with free end gaps, 65% similarity), and a phylogenetic tree was generated (genetic distance model Tamura-Nei, neighbour joining method, bootstrap with 100 replicates).

opencc-by-4.0Oct 2024View details →

zenodo40/100

Resistance tests to anthracnose in common bean

This video shows the steps in resistance tests in controlled conditions to anthracnose (caused by Colletotrichum lindemuthianum (Sacc. & Magnus) Briosi & Cavara,,) in common bean. A dissemination task developed by the Plant Genetic Group (SERIDA) for the BRESOV project. This work is part of the BRESOV project funded by the EU (Grant agreement ID: 774244). Also available in the link:   https://www.youtube.com/watch?v=dLPAq9_7M60

opencc-by-4.0Oct 2021View details →

zenodo40/100

EGMP 2023 Offtake Assessment for Finland and NW Russia / Sweden, Denmark and Germany population of Taiga Bean Goose (former Central MU)

Data and model files for the 2023 EGMP offtake assessment for Finland and NW Russia / Sweden, Denmark and Germany population of Taiga Bean Goose (former Central MU). https://gitlab.com/aewa-egmp/taiga-bean-goose/harvest-assessment-2023

opencc-by-4.0Jul 2023View details →

zenodo40/100

Common Beans Imagery Dataset for Early Detection of Crop Diseases

The annotated dataset consists of common beans leaf imagery for early diseases detection. The common beans crop leaves images were taken in Mbeya region in the Southern Highlands of Tanzania between 20th   October 2022 and 10th April 2023 using a mobile data collection tool, called the Open Data Kit (ODK). The crop leaf imagery dataset use case is developing machine learning models and end-user tools for early detection of (i) Bean anthracnose, and (ii) Bean rust diseases in common beans. The common leaf imagery data was collected from small holder farms using Samsung Galaxy A03 Core smartphones.  All images are in the .zip files; “anthra.zip” has 13,531 images, “healthy.zip” has 24,973 images, and “rust.zip” has 20,568 images. A total of 59,072 image files are labelled. This research project is financially supported by the International Development Research Centre (IDRC) and the Swedish International Development Cooperation Agency (SIDA) through the Artificial Intelligence for Agriculture and Food Systems Innovation Research Network (AI4AFS-IRN) administered by the African Technology Policy Studies Network (ATPS) with Grant Award Number: AI4AFS/GA/AFS-2504001568.

opencc-by-4.0Aug 2023View details →

dryad40/100

Responsiveness of the broad bean weevil Bruchus rufimanus Boh. to different Vicia faba L. genotypes

Open the record for dataset details and reuse information.

publicApr 2024View details →

dryad40/100

Genotyping results of the FabaPanel for: Genetic erosion within the Fabada dry bean market class revealed by high-throughput genotyping

Open the record for dataset details and reuse information.

publicJul 2024View details →

zenodo36/100

Results "Anti-obesity effects of individual or combination treatment with Spirulina platensis and green coffee bean aqueous extracts in high-fat diet-induced obese rats"

Background: Obesity, a chronic disease, is associated with serious health risks, including premature mortality. This study aimed to investigate the anti-obesity effects of individual or combination treatment with Spirulina platensis and green coffee bean aqueous extracts in high-fat diet-induced (HFD) obese rats. Methods: Rats were fed on HFD to induce obesity. Corn oil in the HFD accounted for 50.98 % of the calories. Fifty rats were divided into the following five groups (10 rats/group): control, HFD, HFD-Spirulina, HFD-coffee, HFD-Spirulina and coffee co-treatment groups. The serum levels of lipid, leptin, and insulin, as well as the hepatic mRNA levels of fatty acid synthase (FAS), peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1α), and peroxisome proliferator-activated alpha receptor (PPARα) were estimated. Results: The Spirulina and/or green coffee bean aqueous extracts decreased the final bodyweight and liver weight, and the serum levels of alanine aminotransferase, aspartate aminotransferase, and alkaline phosphatase. Additionally, the extracts decreased the serum levels of total cholesterol, triacylglycerol, low-density lipoprotein-cholesterol, leptin, and glucose, and enhanced the serum insulin level. Furthermore, the extracts enhanced the PGC-1α and PPARα mRNA levels and decreased the FAS mRNA levels. Conclusion: The individual or combination treatment with Spirulina and green coffee bean extracts decreased obesity-induced hyperlipidemia. Thus, Spirulina platensis and green coffee can be potentially used to treat obesity.

opencc-by-4.0May 2020View details →

dryad36/100

Functional groups of wild bees respond differently to faba bean (Vicia faba L.) cultivation at landscape scale

1. Concerns about insect declines are growing and the provisioning of ecosystem services like pollination may be threatened. To safeguard biodiversity, greening measures were introduced within the reform of the EU's Common Agricultural Policy. One measure commonly applied by farmers is the cultivation of nitrogen fixing crops. Although underlying studies are largely missing, this measure is criticized as providing no significant biodiversity benefit. 2. Using a landscape-scale approach, we selected 30 paired study landscapes (1km x 1km) in Germany, i.e. 15 study landscapes with faba bean (FB) fields (Vicia faba L.) and 15 without any grain legumes. Flower-visiting wild bees were recorded with transect walks at the field margins of different crops using a stratified sampling approach. We analyzed the effect of FB cultivation and landscape composition on the abundance and species richness of wild bees as well as on the functional composition of the bee communities. 3. Bumblebee densities (Bombus spp. Latreille) were more than twice as high in FB compared to control landscapes after the flowering of the beans. Non-Bombus wild bee densities, however, were not affected by FB cultivation, but were enhanced by increasing amounts of semi-natural habitats (SNH). 4. After the beans` blooming had ceased, FB landscapes had a higher proportion of wild bees collecting pollen from Fabaceae than control landscapes. The community weighted means for bee size, measured as intertegular distance, were not affected by FB cultivation, but we found smaller species and species with shorter tongues with an increasing percentage of SNH. 5. Synthesis and applications. The cultivation of faba bean (V. faba L.) strongly increased bumblebee densities throughout the season. This indicates that also on-field greening measures can support biodiversity. Nevertheless, since only functional groups adapted to faba bean benefit, measures to promote semi-natural habitats in agricultural landscapes need to be implemented. We conclude that the combination of on- and off-field measures is essential to maintain farmland biodiversity and the Common Agricultural Policy should furthermore promote both.

opencc-zeroAug 2020View details →

zenodo36/100

Raw data : Exploratory survey for the faba bean stem borer, Lixus algirus (Coleoptera: Curculionidae) and its natural enemies in Morocco.

A survey was conducted to determine the distribution of L. algirus and its natural enemies and damage severity in Morocco. A total of 16 and 27 stops were randomly selected and surveyed in the major faba bean-growing regions during 2017 and 2018, respectively.

opencc-by-4.0Nov 2020View details →

dryad36/100

Data from: Genotyping by sequencing and genome–environment associations in wild common bean predict widespread divergent adaptation to drought

Drought will reduce global crop production by >10% in 2050 substantially worsening global malnutrition. Breeding for resistance to drought will require accessing crop genetic diversity found in the wild accessions from the driest high stress ecosystems. Genome–environment associations in crop wild relatives reveal natural adaptation, and therefore can be used to identify adaptive variation. We explored this approach in the food crop Phaseolus vulgaris L., characterizing 86 geo-referenced wild accessions using Genotyping by Sequencing (GBS) to discover single-nucleotide-polymorphisms (SNPs). The wild beans represented Mesoamerica, Guatemala, Colombia, Ecuador/Northern Peru and Andean groupings. We found high polymorphism with a total of 22,845 SNPs across the 86 accessions loci that confirmed genetic relationships for the groups. As a second objective, we quantified allelic associations with a bioclimatic-based drought index using 10 different statistical models that accounted for population structure. Based on the optimum model, 115 SNPs in 90 regions, widespread in all 11 common bean chromosomes, were associated with the bioclimatic-based drought index. A gene coding for an Ankyrin repeat-containing protein and a phototropic-responsive NPH3 gene were identified as potential candidates. Genomic windows of 1Mb containing associated SNPs had more positive Tajima's D scores than windows without associated markers. This indicates that adaptation to drought, as estimated by bioclimatic variables, has been under natural divergent selection, suggesting that drought tolerance may be favorable under dry conditions but harmful in humid conditions. Our work exemplifies that genomic signatures of adaptation are useful for germplasm characterization, potentially enhancing future marker-assisted selection and crop improvement.

opencc-zeroDec 2017View details →

zenodo36/100

Nutrients in 19 samples of home-grown green beans

Analysis of nutrient composition in 19 samples of green beans (snap beans) that were sourced among users of Tomappo gardening application in Slovenia in 2021. Includes data on: Dry matter (%), Ash (%), Fat (%), Protein (%), Isoleucine, Leucine, Valine, Phenylalanine, Histidine, Lysine, Threonine, Methionine, Alanine, Glycine, Proline, Tyrosine, Aspartic acid, Glutamic acid, Arginine, Serine, Cysteine, macro-elements (N, Mg, P, S, K, Ca) and micro-elements (Na, Mn, Fe, Co, Cu, Zn, Mo).

opencc-by-4.0Dec 2023View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas

neuroscienceopenDocumentation, web resources, and API references are available online.

Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage

behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.

Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb

electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.

Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl

behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.

Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro

neuroscienceopenPublished datasets are available on demand over the internet.

Last verified 2026-04-29Open record