Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
220
datasets available to search
ShareScore release 0.9.0
Dataset results
220 results for “Eastern Himalaya”
FIGURES 23–32. Chaudhuriomyia binduensis gen. n in Chaudhuriomyia, a new tanypod genus of Macropelopiini (Diptera: Chironomidae: Tanypodinae) from the Eastern Himalaya
FIGURES 23–32. Chaudhuriomyia binduensis gen. n. sp. n., larva. 23. apex of antenna; 24. mandible; 25. maxilla; 26. mentum & M appendages; 27. ligula & paraligula; 28. pecten hypopharyngis; 29. head capsule with position of cephalic setae & sensory pore–left ventral aspect & right dorsal aspect; 30. cephalic setae & sensory pore (ventral); 31. claws of posterior parapods; 32. claws of posterior parapods.
FIGURES 19–24 in A review of the genus Paraleptomenes Giordani Soika, 1970 (Hymenoptera: Vespidae: Eumeninae: Odynerini) from the Indian subcontinent, with the description of a new species from the eastern Himalayas
FIGURES 19–24. Paraleptomenes rufoniger Giordani Soika, ♂. 19. Body profile; 20. Head, frontal view; 21. Antenna; 22. Head and mesosoma, dorsal view; 23. Metasoma, dorsal view; 24. Genitalia.
FIGURES 1–6 in A review of the genus Paraleptomenes Giordani Soika, 1970 (Hymenoptera: Vespidae: Eumeninae: Odynerini) from the Indian subcontinent, with the description of a new species from the eastern Himalayas
FIGURES 1–6. Paraleptomenes darugiriensis sp. nov. 1–3. Holotype, ♀. 1. Body profile; 2. Head, frontal view; 3. Metasoma, dorsal view. 4–6 Paratype, ♂. 4. Head, frontal view; 5. Antenna; 6. Genitalia.
FIGURES 7–12 in A review of the genus Paraleptomenes Giordani Soika, 1970 (Hymenoptera: Vespidae: Eumeninae: Odynerini) from the Indian subcontinent, with the description of a new species from the eastern Himalayas
FIGURES 7–12. Paraleptomenes humbertianus (de Saussure). 7–11. Female. 7. Body profile; 8. Head, frontal view; 9. Propodeum; 10. T1, dorsal view; 11. Metasoma, dorsal view. 12. Male. Head, frontal view.
FIGURE 6 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)
FIGURE 6. Male genitalia of Cinygmula longissima sp. nov. A: genitalia (dorsal view); B: genitalia (ventral view); C: penes (dorsal view); D: penes (ventral view); E: titillators of penes; F: lateral spine
FIGURE 4 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)
FIGURE 4. Male imago of Cinygmula longissima sp. nov. A: habitus; B: legs (fore–, mid– and hindlegs from left to right and foreclaws enlarged); C: head (dorsal view); D: head (lateral view)
FIGURE 3 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)
FIGURE 3. Nymphal mouthparts of Cinygmula longissima sp. nov. A: labrum (dorsal view); B: left mandible (dorsal view); C: right mandible (dorsal view); D. hypopharynx (dorsal view); E: left maxilla (ventral view); F: labium (ventral view)
FIGURE 2 in A new Cinygmula McDunnough, 1933 species with distinct imaginal frontal fold from eastern Chinese Himalaya (Ephemeroptera: Heptageniidae)
FIGURE 2. Nymphal structures of Cinygmula longissima sp. nov. A: head of a mature nymph (showing the frontal fold in the shell, dorsal view); B: head capsule (showing the shape, dorsal view); C: fore–, mid– and hindleg (from above to bottom); D. Gills I–VII (from left to right)
Table 1 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species
<p><b>Table 1.</b> Primers used for PCR and sequencing</p><table><tbody><tr><th>Locus</th><th>Primer name</th><th>Primer sequences</th><th>Sense/anti-sense</th><th>Reference</th></tr></tbody><tbody><tr><th><i>CYT B</i></th><td>L14724_hk3</td><td>GGACTTATGACATGAAAAATCATCGTTG</td><td>Sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><td>H15915_hk3</td><td>GATTCCCCATTTCTGGTTTACAAGAC</td><td>Anti-sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><th>12S</th><td>L613_hk1</td><td>GGCGGGCGAGCAAAGCACTGAAAATG</td><td>Sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><td>H1478_hk1</td><td>TGATTGGTGGAGGGTGACGAGCGGTGTGT</td><td>Anti-sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><th><i>BRCA1</i></th><td>B1f</td><td>TGAGAACAGCACTTTATTACTCAC</td><td>Sense</td><td>Dubey <i>et al.</i>, 2006</td></tr><tr><td>B1r</td><td>ATTCTAGTTCCATATTGCTTATACTG</td><td>Anti-sense</td><td>Dubey <i>et al.</i>, 2006</td></tr><tr><th><i>APOB</i></th><td>ApoBf</td><td>GCAATCATTTGACTTAAGTG</td><td>Sense</td><td>Dubey <i>et al.</i>, 2007</td></tr><tr><td>ApoBr</td><td>GAGCAACAATATCTGATTGG</td><td>Anti-sense</td><td>Dubey <i>et al.</i>, 2007</td></tr><tr><th><i>RAG2</i></th><td>RAG2-F220</td><td>GATTCCTGCTAYCTYCCTCCTCT</td><td>Sense</td><td>Teeling <i>et al.</i>, 2000</td></tr><tr><td>RAG2-R995</td><td>CCCATGTTGCTTCCAAACCATA</td><td>Anti-sense</td><td>Teeling <i>et al.</i>, 2000</td></tr></tbody></table>
Figure 2 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species
Figure 2. Dorsal, ventral and lateral views of the skull and lateral views of the mandible of the holotype of Alpiscaptulus medogensis (KIZ: 037966; left) and Scapanulus oweni (KIZ: 033872; right). Scale bar = 10 mm.
Figure 5 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species
Figure 5. Results of maximum likelihood phylogenetic analyses of concatenated (A) mitochondrial genes, (B) nuclear genes and (C) mitochondrial-nuclear trees. Node numbers indicate Bayesian posterior probabilities (PP) and ultrafast bootstrap supports (UFBoot). Branch lengths represent substitutions per site.
Subspecies and Distribution. S. s. scrofa Linnaeus, 1758 — W Europe, from Denmark, Germany, Poland, and Czech Republic to N Italy and N Iberian Peninsula; possibly also Albania. The taxonomic status of animals in Austria, Switzerland, Slovenia, and Slovakia is unclear but presumably these populations are included in scrofa, as are the populations of Sweden, Finland, and the Baltic states. However, restocking of once depleted populations, for example in Italy, has likely involved the introduction and mixing of this subspecies with other subspecies, such as attila. S. s. affinis Gray, 1847 — S India and Sri Lanka. S. s. algirus Loche, 1867 — Tunisia, Algeria, and Morocco, on the coastal side of the mountains or in the low montane areas. S. s. attila Thomas, 1912 — Hungary, Ukraine, C & S Belarus, Romania, Moldova, and S Russia towards the N flank of the Caucasus, but not including the Transcaucasian countries of Georgia, Armenia, and Azerbaijan. The range possibly extends as far S as the Mesopotamian Delta in Iraq, in which case it would likely include W & SW Iran, and possibly E Turkey and Syria, where it borders with lybicus. Such a range could not be easily reconciled with a statement by Groves that "the difference between pigs from N and S of the Caucasus is quite striking; Transcaucasian boars are certainly not attila." This subspecies may also extend into C Asia and include Kazakhstan, Uzbekistan, and Turkmenistan, but no data exist to support this. S. s. baeticus Thomas, 1912 — originally described from Coto Donana, S Spain, and later merged with meridionalis; also S Portugal. Unless evidence is found that these Italian and Iberian populations are the relics of a much larger formerly contiguous range, this subspecies should be kept as distinct. S. s. coreanus Heude, 1897 — Korean Peninsula. S. s. eristatus Wagner, 1839 — Himalayas S to C India and E to Indochina (N of the Kra Isthmus). S. s. davidi Groves, 1981 — the arid zone from E Iran to Gujarat, including Pakistan and NW India, and perhaps N to Tajikistan. S. s. leucomystax Temminck, 1842 — main Is ofJapan (Honshu, Shikoku, Kyushu, Nakadori, Hiburijima, Tojima, Kushima, and other smaller Is). S. s. lybicus Gray, 1868 — Bulgaria, Greece, Turkey, Syria, Jordan, Israel, Palestine, in the past also in Lybia, and Egypt. The former Yugoslavia was included in its range, which would suggest that now Slovenia, Serbia, Croatia, Bosnia and Herzegovina, Montenegro, and Kosovo are within the range of this subspecies, although the exact boundaries are unclear. Pigs from Albania have been assigned to S. s. scrofa. S. s. majori De Beaux & Festa, 1927 — C & S Italian Peninsula. S. s. menidionalis Forsyth Major, 1882 — Corsica and Sardinia, with the proviso that the two populations are very likely to be introduced or feral. S. s. moupinensis Milne-Edwards, 1871 — China, S to Vietnam and W to Sichuan. S. s. nigripes Blanford, 1875 — the flanks of the Tianshan mountains in Kyrgyzstan and NW China (Xinjiang). An animal photographed in NE Iran (Golestan) looked like this subspecies. S. s. nukiuanus Kuroda, 1924 — Iriomote, Ishigaki, Okinawa, Tokunoshima, Amamioshima, and Kakerome Is in the Ryukyu chain in extreme S Japan, though some of these populations have hybridized with introduced domesticates. S. s. sibiricus Staffe, 1922 — Mongolia and Transbaikal (S & E of Lake Baikal). S. s. tawvanus Swinhoe, 1863 — Taiwan. S. s. ussuricus Heude, 1888 — far E Russia and the Manchurian region (China). Korean populations were previously included in this subspecies, but based on new evidence, the Korean taxon seems more similar to moupinensis. S. s. vittatus Boie, 1828 — Malay Peninsula, S of the Isthmus of Kra, the offshore islands of Terutai and Langkawi, Sumatra, Riau Archipelago, Java, Bali, and a range of smaller islands around these, including Babi, Bakong, Batam, Bawean, Bengkalis, Bintan, Bulan, Bunguran, Cuyo, Deli, Durian, Enggano, Galang, Jambongan, Karimon (Riau Is), Kundur, Lagong, Laut, Lingga, Lingung, Mapor, Moro Kecil, North Pagai, Nias, Panaitan, Payong, Penang, Pinie, Rupat, Siantan, Siberut, Simeulue, Singkep, Sugi, Sugi Bawa, Telibon, Tinggi, Tuangku, and the Tambelan Is. This species was originally present from the British Is in the extreme W, through Eurasia from S Scandinavia to S Siberia, extending as far E as Korea and Japan, and SE into some of the Sunda Is and Taiwan. In the S the species ranged along the Nile Valley to Khartoum, and N of the Sahara in Africa, more orless following the continental coasts of S, E, and SE Asia. Within this range it was absent only from extremely dry deserts, e.g. the driest regions of Mongolia and in China W of Sichuan; and alpine zones, such as the high altitudes of Pamir and Tien Shan. In recent centuries, the range of S. scrofa has changed dramatically because of hunting and changes in available habitat. The species disappeared from the British Is in the 17" century, from Denmark in the 19" century, and was greatly reduced in range and numbers in the 20" century from areas as distant as Tunisia, Sudan, Germany, and Russia. Following these severe declines, there were some slight population recoveries in Russia, Italy, Spain, and Germany in the mid-20™ century, and natural and assisted range expansions in Denmark and Sweden. The species has also been inadvertently reintroduced in various locations in the Great Britain via escapees of mixed origin from commercial farming enterprises. Ex-S. scrofa stocks also occur as introduced feral populations in various other parts of the world, including Australia, New Zealand, the eastern Malay Archipelago, and in North, Central, and South America. In all of these areas they are now generally recognized as a major pest. in Suidae
Subspecies and Distribution. S. s. scrofa Linnaeus, 1758 — W Europe, from Denmark, Germany, Poland, and Czech Republic to N Italy and N Iberian Peninsula; possibly also Albania. The taxonomic status of animals in Austria, Switzerland, Slovenia, and Slovakia is unclear but presumably these populations are included in scrofa, as are the populations of Sweden, Finland, and the Baltic states. However, restocking of once depleted populations, for example in Italy, has likely involved the introduction and mixing of this subspecies with other subspecies, such as attila. S. s. affinis Gray, 1847 — S India and Sri Lanka. S. s. algirus Loche, 1867 — Tunisia, Algeria, and Morocco, on the coastal side of the mountains or in the low montane areas. S. s. attila Thomas, 1912 — Hungary, Ukraine, C & S Belarus, Romania, Moldova, and S Russia towards the N flank of the Caucasus, but not including the Transcaucasian countries of Georgia, Armenia, and Azerbaijan. The range possibly extends as far S as the Mesopotamian Delta in Iraq, in which case it would likely include W & SW Iran, and possibly E Turkey and Syria, where it borders with lybicus. Such a range could not be easily reconciled with a statement by Groves that "the difference between pigs from N and S of the Caucasus is quite striking; Transcaucasian boars are certainly not attila." This subspecies may also extend into C Asia and include Kazakhstan, Uzbekistan, and Turkmenistan, but no data exist to support this. S. s. baeticus Thomas, 1912 — originally described from Coto Donana, S Spain, and later merged with meridionalis; also S Portugal. Unless evidence is found that these Italian and Iberian populations are the relics of a much larger formerly contiguous range, this subspecies should be kept as distinct. S. s. coreanus Heude, 1897 — Korean Peninsula. S. s. eristatus Wagner, 1839 — Himalayas S to C India and E to Indochina (N of the Kra Isthmus). S. s. davidi Groves, 1981 — the arid zone from E Iran to Gujarat, including Pakistan and NW India, and perhaps N to Tajikistan. S. s. leucomystax Temminck, 1842 — main Is ofJapan (Honshu, Shikoku, Kyushu, Nakadori, Hiburijima, Tojima, Kushima, and other smaller Is). S. s. lybicus Gray, 1868 — Bulgaria, Greece, Turkey, Syria, Jordan, Israel, Palestine, in the past also in Lybia, and Egypt. The former Yugoslavia was included in its range, which would suggest that now Slovenia, Serbia, Croatia, Bosnia and Herzegovina, Montenegro, and Kosovo are within the range of this subspecies, although the exact boundaries are unclear. Pigs from Albania have been assigned to S. s. scrofa. S. s. majori De Beaux & Festa, 1927 — C & S Italian Peninsula. S. s. menidionalis Forsyth Major, 1882 — Corsica and Sardinia, with the proviso that the two populations are very likely to be introduced or feral. S. s. moupinensis Milne-Edwards, 1871 — China, S to Vietnam and W to Sichuan. S. s. nigripes Blanford, 1875 — the flanks of the Tianshan mountains in Kyrgyzstan and NW China (Xinjiang). An animal photographed in NE Iran (Golestan) looked like this subspecies. S. s. nukiuanus Kuroda, 1924 — Iriomote, Ishigaki, Okinawa, Tokunoshima, Amamioshima, and Kakerome Is in the Ryukyu chain in extreme S Japan, though some of these populations have hybridized with introduced domesticates. S. s. sibiricus Staffe, 1922 — Mongolia and Transbaikal (S & E of Lake Baikal). S. s. tawvanus Swinhoe, 1863 — Taiwan. S. s. ussuricus Heude, 1888 — far E Russia and the Manchurian region (China). Korean populations were previously included in this subspecies, but based on new evidence, the Korean taxon seems more similar to moupinensis. S. s. vittatus Boie, 1828 — Malay Peninsula, S of the Isthmus of Kra, the offshore islands of Terutai and Langkawi, Sumatra, Riau Archipelago, Java, Bali, and a range of smaller islands around these, including Babi, Bakong, Batam, Bawean, Bengkalis, Bintan, Bulan, Bunguran, Cuyo, Deli, Durian, Enggano, Galang, Jambongan, Karimon (Riau Is), Kundur, Lagong, Laut, Lingga, Lingung, Mapor, Moro Kecil, North Pagai, Nias, Panaitan, Payong, Penang, Pinie, Rupat, Siantan, Siberut, Simeulue, Singkep, Sugi, Sugi Bawa, Telibon, Tinggi, Tuangku, and the Tambelan Is. This species was originally present from the British Is in the extreme W, through Eurasia from S Scandinavia to S Siberia, extending as far E as Korea and Japan, and SE into some of the Sunda Is and Taiwan. In the S the species ranged along the Nile Valley to Khartoum, and N of the Sahara in Africa, more orless following the continental coasts of S, E, and SE Asia. Within this range it was absent only from extremely dry deserts, e.g. the driest regions of Mongolia and in China W of Sichuan; and alpine zones, such as the high altitudes of Pamir and Tien Shan. In recent centuries, the range of S. scrofa has changed dramatically because of hunting and changes in available habitat. The species disappeared from the British Is in the 17" century, from Denmark in the 19" century, and was greatly reduced in range and numbers in the 20" century from areas as distant as Tunisia, Sudan, Germany, and Russia. Following these severe declines, there were some slight population recoveries in Russia, Italy, Spain, and Germany in the mid-20™ century, and natural and assisted range expansions in Denmark and Sweden. The species has also been inadvertently reintroduced in various locations in the Great Britain via escapees of mixed origin from commercial farming enterprises. Ex-S. scrofa stocks also occur as introduced feral populations in various other parts of the world, including Australia, New Zealand, the eastern Malay Archipelago, and in North, Central, and South America. In all of these areas they are now generally recognized as a major pest.
FIGURE 2 in A new species of Zographetus Watson, 1893 (Lepidoptera: Hesperiidae) from Sikkim, eastern Himalaya, India
FIGURE 2. Male genitalia of paratypes of Zographetus dzonguensis sp. nov. A. lateral view of genital capsule, B. valva, C. aedeagus, D. dorsal view of genital capsule, E. ventral view of genital capsule, F. juxta. In IBC-BM770, 'A' shows the outside of the right valve, and 'B' shows inside of the left valve (left valve was separated from the genital capsule and then photographed). In IBC-BM772, 'A' shows inside of the left valve, and 'B' shows outside of the right valve (right valve was separated from the genital capsule and then photographed).
FIGURE 3 in A new species of Zographetus Watson, 1893 (Lepidoptera: Hesperiidae) from Sikkim, eastern Himalaya, India
FIGURE 3. Zographetus dzonguensis sp. nov. in life. All individuals were photographed at Namprikdang playground, Dzongu, North Sikkim District, Sikkim, India in August-September 2020 and 2021. Photographs © Sonam Wangchuk Lepcha.
Tropical forest restoration in the Eastern Himalaya: Evaluating early survival and growth of native tree species
<p>Asian tropical forests have among the highest rates of forest loss in the world. Ecological restoration is a vital step for biodiversity maintenance and climate change mitigation. For restoration practice, evaluation of species performance at early stages is crucial to avoid failure of the efforts and for screening species suitable to a region. Though the long-term performance of restoration plantings has been well-documented, few studies have evaluated the performance during the establishment of the planted saplings, especially in South and Southeast Asia. Restoration efforts in Northeast India, a region experiencing high forest loss, is limited by the lack of species-specific data on survival and growth. We compared inter-specific variation in seasonal survival and growth rates (diameter and height) for multiple native rainforest species from this region. We planted 3022 saplings of 50 species at a degraded open forest site. After 18 months, sapling survival varied between 9.1–94.3% for 32 species, and only six species showed "excellent" survival after 18 months. Eight out of 17 species that were tested for seasonal variation in survival showed significant differences in survival between seasons. While the diameter growth rate varied for species between seasons, the height growth rate was different between both species and season, but the interaction term between species and season was not significant. Certain animal-dispersed, medium to large-seeded primary forest species performed well and are vital for future restoration efforts in this region.</p>
FIGURE 5 in On two species of Gymnomitrion (Gymnomitriaceae, Marchantiophyta) in the Eastern Sino-Himalaya
FIGURE 5. Gymnomitrion rubidum subsp. subvittatum Vilnet, Bakalin & D.G. Long: A—mat, dorsal view; B—part of leaf base with 'vitta' cells (reddish rusty colored group of cells); C, E—midleaf cells; D—leaf lobe cells. Scales: for A—5 mm; for B–E—50 µm. A, C, D from Long 20655 (E), B, E from Long 34462 (E).
FIGURE 1 in On two species of Gymnomitrion (Gymnomitriaceae, Marchantiophyta) in the Eastern Sino-Himalaya
FIGURE 1. Phylogram obtained in a maximum likelihood calculation for the genus Gymnomitrion based on ITS1-2+trnL-F dataset. Bootstrap support values of maximum likelihood and maximum parsimony analyses more than 50% and Bayesian posterior probabilities more than 0.50 are indicated. The GenBank accession number (ITS1-2/trnL-F) are provided.
FIGURE 9 in On two species of Gymnomitrion (Gymnomitriaceae, Marchantiophyta) in the Eastern Sino-Himalaya
FIGURE 9. Gymnomitrion rubidum (Mitt.) Váňa, Crand.-Stotl. et Stotler subsp. rubidum: A—plant habit, fragment, lateral view; B— plant habit with sporogonium, fragment, lateral view. Scales: for A—1 mm; for B—1 mm. All from isolectotype (JE 04000310).
FIGURE 7 in On two species of Gymnomitrion (Gymnomitriaceae, Marchantiophyta) in the Eastern Sino-Himalaya
FIGURE 7. Gymnomitrion rubidum (Mitt.) Váňa, Crand.-Stotl. et Stotler subsp. rubidum: A—plant habit, fragment, ventral view; B— plant habit, fragment, dorsal view; C—plant habit, fragment, lateral view; D–L—leaves; M—stem cross-section; N—midleaf cells; O— cells in leaf lobe apex; P—leaf margin cells; Q—cells in leaf base. Scales: a—1 mm for A–C; b—1 mm for D–L; c—100 µm for M–Q. All from V-19-6-18 (VBGI).
FIGURE 6 in On two species of Gymnomitrion (Gymnomitriaceae, Marchantiophyta) in the Eastern Sino-Himalaya
FIGURE 6. Gymnomitrion rubidum subsp. subvittatum Vilnet, Bakalin et D.G. Long: A—plant habit in dorsal and ventral views; B, C—lower part of leaf with 'vitta' cells. Scales: for A—1 mm; for B, C—300 µm. A from Long 20655 (E), B, C from Long 34462 (E).
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.