Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
144
datasets available to search
ShareScore release 0.9.0
Dataset results
144 results for “ISO”
System Accuracy Evaluation of Karajishi Contour and Karajishi TS Blood Glucose Monitoring Systems Following ISO 15197:2013
ClinicalTrials.gov study NCT02358408. IPD Sharing: Not stated. Countries: 1. Publications: 1.
Individualized Music Playlist Based on ISO-Principle for De-escalating Agitation of People Living With Dementia
ClinicalTrials.gov study NCT04236557. IPD Sharing: NO. Countries: 1. Publications: 40.
Comparison Between Iso-Osmolar and Ipo-Osmolar Contrast Agents in Patients With Acute Myocardial Infarction (AMI) Undergoing Primary Percutaneous Coronary Intervention (PCI)
ClinicalTrials.gov study NCT00827788. IPD Sharing: Not stated. Countries: 1. Publications: 1.
Dose-Escalation Safety and Pharmacokinetic Study of Iso-Fludelone in Patients With Advanced Solid Tumors
ClinicalTrials.gov study NCT01379287. IPD Sharing: Not stated. Countries: 1. Publications: 1.
Single cell Iso-Sequencing enables rapid genome annotation for scRNAseq analysis
Open the record for dataset details and reuse information.
Aminoacyl-tRNA synthetase gene alignments from multiple Sileneae species generated from full-length transcripts using Iso-Seq and raw microscopy image files
Open the record for dataset details and reuse information.
A high-performance Ni-CeO2/Ni/Ni-Y2O3·ZrO2 three-layer anode for direct iso-octane feeding of solid oxide fuel cells
Open the record for dataset details and reuse information.
Data from: Metabolites of n-Butylparaben and iso-Butylparaben exhibit estrogenic properties in MCF-7 and T47D human breast cancer cell lines
Two oxidized metabolites of n-butylparaben (BuP) and iso-butylparaben (IsoBuP) discovered in human urine samples exhibit structural similarity to endogenous estrogens. We hypothesized that these metabolites bind to the human estrogen receptor (ER) and promote estrogen signaling. We tested this using models of ER-mediated cellular proliferation. The estrogenic properties of 3-hydroxy n-butyl 4-hydroxybenzoate (3OH) and 2-hydroxy iso-butyl 4-hydroxybenzoate (2OH) were determined using the ER-positive, estrogen-dependent human breast cancer cell lines MCF-7, and T47D. The 3OH metabolite induced cellular proliferation with EC50 of 8.2 µM in MCF-7 cells. The EC50 for 3OH in T47D cells could not be reached. The 2OH metabolite induced proliferation with EC50 of 2.2 µM and 43.0 µM in MCF-7 and T47D cells, respectively. The EC50 for the parental IsoBuP and BuP was 0.30 and 1.2 µM in MCF-7 cells, respectively. The expression of a pro-proliferative, estrogen-inducible gene (GREB1) was induced by these compounds and blocked by co-administration of an ER antagonist (ICI 182, 780), confirming the ER-dependence of these effects. The metabolites promoted significant ER-dependent transcriptional activity of an ERE-luciferase reporter construct at 10 and 20 µM for 2OH and 10 µM for 3OH. Computational docking studies showed that the paraben compounds exhibited the potential for favorable ligand-binding domain interactions with human ERα in a manner similar to known x-ray crystal structures of 17ß-estradiol in complex with ERα. We conclude that the hydroxylated metabolites of BuP and IsoBuP are weak estrogens and should be considered as additional components of potential endocrine disrupting effects upon paraben exposure.
List of languages mentioned in the article Continuative cycle together with their ISO codes
Open the record for dataset details and reuse information.
IMOM ABU ISO TERMIZIYNING ILMIY-MA'NAVIY MEROSI
Open the record for dataset details and reuse information.
SNCA targeted cDNA: PacBio Iso-Seq raw data
<p><strong>The landscape of <em>SNCA</em> transcripts across </strong><strong>synucleinopathies</strong><strong>: New insights from long reads sequencing analysis</strong></p> <p><strong>cDNA capture using IDT xGen</strong><strong>® Lockdown</strong><strong>® Probes and single-molecule Isoform-Sequencing (Iso-Seq)</strong></p> <p>100-150ng of total RNA per reaction was reverse transcribed using the Clontech SMARTer cDNA synthesis kit and 12 sample specific barcoded oligo dT (with PacBio 16mer barcode sequences, see Supplementary Methods). Three reverse transcription (RT) reactions were processed in parallel for each sample. PCR optimization was used to determine the optimal amplification cycle number for the downstream large-scale PCR reactions. A single primer (primer IIA from the Clontech SMARTer kit 5’ AAG CAG TGG TAT CAA CGC AGA GTA C 3’) was used for all PCR reactions post-RT. Large scale PCR products were purified separately with 1X AMPure PB beads and the bioanalyzer was used for QC. An equimolar pool of 12-plex barcoded cDNA library (1µg total) was input into the probe based capture with a custom designed SNCA gene panel.</p> <p>A SMRTBell library was constructed using 874ng of captured and re-amplified cDNA (https://www.pacb.com/wp-content/uploads/Procedure-Checklist-%E2%80%93-cDNA-Capture-Using-IDT-xGen-Lockdown-Probes.pdf). One SMRT Cell (6 hour movie) was sequenced on the PacBio Sequel platform using 2.0 chemistry. </p> <p> </p> <p> </p> <p>The 5’ primer is identical for all patient samples: AAGCAGTGGTATCAACGCAGAGTACATGGG</p> <p>The 3’ primer for the 12 patient samples are below:</p> <p>PD-1: CGCACTCTGATATGTGGTACTCTGCGTTGATACCACTGCTT</p> <p>PD-2: CTCACAGTCTGTGTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>PD-3: CTCTCACGAGATGTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>PD-4: CGCGCGTGTGTGCGTGGTACTCTGCGTTGATACCACTGCT</p> <p>N-1: ACGCGAGAGTCGAGTGGTACTCTGCGTTGATACCACTGCTT</p> <p>N-2: ACAGCTGATATATATGGTACTCTGCGTTGATACCACTGCTT</p> <p>N-3: CACATAGAGATACAGAGTACTCTGCGTTGATACCACTGCTT</p> <p>N-4: CGCAGCGCTCGACTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-1: TCTGTCTCGCGTGTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-2: CTCTGAGATAGCGCGTGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-3: ATAGATATACGTATAGGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-4: ACACGCGATCTAGTGTGTACTCTGCGTTGATACCACTGCTT</p>
Data from: The tendinopathic Achilles tendon does not remain iso-volumetric upon repeated loading: insights from 3D ultrasound
Mid-portion Achilles tendinopathy (MAT) alters the normal three-dimensional (3D) morphology of the Achilles tendon (AT) at rest and under a single tensile load. However, how MAT changes the 3D morphology of the AT during repeated loading remains unclear. This study compared the AT longitudinal, transverse and volume strains during repeated loading of the tendinopathic AT with those of the contralateral tendon in people with unilateral MAT. Ten adults with unilateral MAT performed 10 successive 25 s submaximal (50%) voluntary isometric plantarflexion contractions with both legs. Freehand 3D ultrasound scans were recorded and used to measure whole AT, free AT and proximal AT longitudinal strains and free AT cross-sectional area (CSA) and volume strains. The free AT experienced higher longitudinal and CSA strain and reached steady state following a greater number of contractions (five contractions) in the tendinopathic AT compared with the contralateral tendon (three contractions). Further, free tendon CSA and volume strain were greater in the tendinopathic AT than in the contralateral tendon from the first contraction, whereas free AT longitudinal strain was not greater than that of the contralateral tendon until the fourth contraction. Volume loss from the tendon core therefore preceded the greater longitudinal strain in the tendinopathic AT. Overall, these findings suggest that the tendinopathic free AT experiences an exaggerated longitudinal and transverse strain response under repeated loading that is underpinned by an altered interaction between solid and fluid tendon matrix components. These alterations are indicative of accentuated poroelasticity and an altered local stress–strain environment within the tendinopathic free tendon matrix, which could affect tendon remodelling via mechanobiological pathways.
KI Process, ISO 9001, and CMMi-DEV models
<p>1) Original Ki Process Diagram</p> <p>2) Agile Ki Process reconfigured with SCRUM, XP, and UX practices.</p> <p>3) ISO 9001 reference model. Contains Clauses 7 to 10.</p> <p>4) CMMi-DEV model. Contain process areas related to Maturity Level 3.</p>
ISO 25964: a standard in support of KOS interoperability
<p>ISO 25964: Information and documentation – Thesauri and interoperability with other vocabularies will be a two-part standard that updates and revises the existing international standards for monolingual and multilingual thesauri. And not just that: it should also help thesauri to play their full part in access to networked resources, particularly in a Semantic Web context. Part 1 (dealing with the development and establishment of thesauri) is on track for publication in 2011, while Part 2 (focusing on interoperability) is scheduled for completion in 2012. A large part of the content is intended to standardize mapping between one vocabulary and another.</p>
ModPG3 Adult/Ped ISO 81060-2:2018 Study Protocol
ClinicalTrials.gov study NCT05654714. IPD Sharing: YES. Countries: 1. Publications: 0.
Performance Evaluation of Blood Glucose Monitoring System Using ISO Study Design
ClinicalTrials.gov study NCT01575080. IPD Sharing: Not stated. Countries: 1. Publications: 0.
Timmy3 Module Clinical Accuracy ISO 80601-2-56:2017 + A1 2018
ClinicalTrials.gov study NCT06056011. IPD Sharing: NO. Countries: 1. Publications: 0.
The Effect of Iso-Principal Based Music Playlists on Anxiety
ClinicalTrials.gov study NCT05442099. IPD Sharing: YES. Countries: 0. Publications: 11.
Data from: The tendinopathic Achilles tendon does not remain iso-volumetric upon repeated loading: insights from 3D ultrasound
Open the record for dataset details and reuse information.
Data from: Metabolites of n-Butylparaben and iso-Butylparaben exhibit estrogenic properties in MCF-7 and T47D human breast cancer cell lines
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.