Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
80
datasets available to search
ShareScore release 0.7.1
Dataset results
80 results for “Liphistius”
Fig. 18 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1
Fig. 18. Liphistius indra sp. nov., vulval plate of four female paratypes (all from exuviae): moult 15.III.2012 (A-B), moult 10.II.2001 (C-D), moult 15.VIII.2002 (E-F), moult 3.XI.2001 (G-H). (A, C, E) Entire structure, dorsal view. (B, D, F) Same, ventral view. (G) Anterior part of vulval plate, ventral view. (H) Receptacular cluster, ventral view. Scale lines: 1.0 mm (A-D, G-H; E-F).
Fig. 1 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1
Fig. 1. Localities of Liphistius species of the malayanus- group, tioman-group, linang-group and batuenis-group in peninsular Malaysia and southern Thailand (coast of Sumatra omitted): 1 - Gunung Angsi (type locality of L. malayanus); 2 - Templer Park and Gua Anak Takun (L. malayanus, L. batuensis); 3 - Genting Highlands (L. malayanus); 4 - Fraser's Hill (L. malayanus); 5 - Cameron Highlands (type locality of L. malayanus cameroni); 6 - Sungai Jasin in Endau Rompin National Park (type locality of L. endau); 7 - Gunung Belumut (L. endau); 8 - Gunung Muntahak (L. endau; type locality of L. gracilis sp. nov.); 9 - Sungai Rengit (type locality of L. johore); 10 - Gunung Kajang on Tioman Island (type locality of L. tioman); 11 - Gua Charas in Bukit Charas (type locality of L. panching); 12 - Nusa Camp in Taman Negara (type locality of L. negara sp. nov.); 13 - Jeram Linang Waterfall (type locality of L. linang sp. nov.); 14 - Sankalakhierie Mountains (type locality of L. indra); 15 - Batu Caves (type locality of L. batuensis); 16 - Gua Tempurung (type locality of L. tempurung); 17 - Gua Cicak (L. tempurung); 18 - Gua Keris (type locality of L. priceae sp. nov). Localities with conspecific populations are encircled. Colours distinguish species groups.
Fig. 14 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1
Fig. 14. Liphistius negara sp. nov., details of left palp of male holotype (A-C, E-H) and of male paratype (D); vulval plate of female allotype (I-J). (A) Distal part of palp, ventral view. (B) Distal part of tibia and base of tarsus, retroventral view. (C-D) Palpal organ, distal view (dorsal side up). (E) Same, proventral view. (F) Same, retrodorsal view. (G) Tibial apophysis, retrolateral and slightly proximal view. (H) Distal part of cymbium, prolateral view. (I) Vulval plate, dorsal view. (J) Same, ventral view. Abbreviation: t - tooth on distal edge of contrategulum. Scale lines: 1.0 mm (A; B, G-H; C-D; E-F; I-J).
Fig. 10 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1
Fig. 10. Liphistius johore, female holotype (A); Liphistius panching, male from type locality (B). (A) Dorsal view of vulval plate (redrawn from Platnick & Sedgwick, 1984: fig. 79) (arrows indicating anterolateral invaginations in margin of poreplate). (B) Distal view of left palpal organ (dorsal side up) (redrawn from Sedgwick & Platnick, 1986: fig. 5).
Fig. 12 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1
Fig. 12. Liphistius tioman, vulval plate of three females from the type locality: specimen moulted 17.XII.2001 (A-B); exuvia, moult 7.VI.2003 (C-E); exuvia, moult 16.II.2002 (F-G). (A, C, F) Entire structure, dorsal view. (B, D, G) Same, ventral view (vesicles in G omitted). (E) Receptacular cluster, ventral and slightly posterior view. Scale lines: 1.0 mm (A-B; C-G).
Fig. 20 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1
Fig. 20. Liphistius batuensis, vulval plate of five females from the type locality: exuvia, moult 24.I.2002 (A-B); specimen SMF 13907 (C); exuvia, moult 12.VII.2001 (D-E); specimen leg. XI.1976 (F); exuvia, moult 13.I.2002 (G-H). (A, C-D, F-G) Dorsal view. (B, E, H) Ventral view. Scale lines: 1.0 mm (A-B, D-E, G-H; C, F).
Fig. 2 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1
Fig. 2. Habitus of two Liphistius species from peninsular Malaysia and southern Thailand. (A) Liphistius endau, female from Kota Tinggi (Malaysia), dorsal view. (B) Liphistius indra sp. nov., male paratype from the Sankalakhierie Mountains (Thailand), same view.
Fig. 9 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1
Fig. 9. Liphistius gracilis sp. nov., vulval plate of three females (all from exuviae): allotype (A-B); paratype, moult 31.VIII.2001 (C- D); paratype, moult 27.IX.2001 (E-G). (A, C, E) Vulval plate, dorsal view. (B, D, F) Same, ventral view. (G) Same, anterior view. Scale lines: 1.0 mm (A-B; C-G).
Fig. 16 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1
Fig. 16. Liphistius linang sp. nov., vulval plate of three female paratypes (A-E): specimen moulted 30.VII.1999 (A-B), moulted 10.III.2000 (C), exuvia, moult 14.IX.1999 (D-E); undissected genital sternite of allotype (F). (A, C-D) Dorsal view. (B, E, F) Ventral view. Scale lines: 1.0 mm (A-E; F).
Figure 4 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
Figure 4. The historical biogeography of Liphistius. A, chronogram and ancestral area reconstructions for Liphistius. The numbers in front of the names of taxa correspond to those in Table 1. B, distribution routes of the trang species group (red arrows) and the bristowei species group (blue arrows). Areas are as follows: A = Mainland Sibumasu; B = Peninsular Sibumasu; C = Inthanon region; D = Central basin; E = Bentong–Reaub suture zone; F = Sukhothai terrain; G = Chantaburi region; H = Indochina terrain (based on Metcalfe 2017); I = East Asia [the distributions of all heptatheline taxa combined into a single area (not shown)].
Figure 3 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
Figure 3. Results of eight species delimitation methods. Each vertical bar represents a different delimitation method, and each horizontal bar represents a putative delimited species. Taxa 1–5 are each represented by only a single specimen. The colours in the phylogenetic tree represent Liphistius species groups, as follows: red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in Sibumasu; blue, trang group from localities in Indochina.
Figure 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
Figure 2. Multi-locus phylogeny using Bayesian inference (BI) with 'GBLOCK partition' alignments. Dashed lines show incongruent clades between Bayesian inference and maximum likelihood (ML). Coloured branches on the tree correspond to Liphistius species groups as follows: red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in Sibumasu; blue, trang group from localities in Indochina.
Figure 1 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
Figure 1. Distribution map of Liphistius. A, sample collection localities. Numbered collection locations correspond to those in Table 1. B, geological terrain: Sibumasu in the west (purple) and Indochina in the east (blue).
Table 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
<p><b>Table 2.</b> Primers used and their annealing temperatures.</p><table><tbody><tr><th><b>Gene</b></th><th><b>Primer</b></th><th><b>Sequence (5</b> <i>ʹ</i> <b>–3</b> <i>ʹ</i><b>)</b></th><th><b>Annealing temperature (°C)</b></th><th><b>Reference</b></th></tr></tbody><tbody><tr><th><i>CO1</i></th><td>LCO1490</td><td>GGTCAACAAATCATAAAGATATTGG</td><td>40</td><td>Folmer <i>et al</i>. (1994)</td></tr><tr><th></th><td>HCO2198</td><td>TAAACTTCAGGGTGACCAAAAAATCA</td><td>40</td><td>Folmer <i>et al</i>. (1994)</td></tr><tr><th>16S</th><td>16Sar</td><td>ATAGAGCTCCCATGGCGCCTGTTTAT CAAAAACAT</td><td>54</td><td>Huber <i>et al</i>. (1993)</td></tr><tr><th></th><td>16Sbr</td><td>ATAGAGCTCCCATGGCCGGTCTGAA CTCAGATCACGT</td><td>54</td><td>Huber <i>et al</i>. (1993)</td></tr><tr><th>ITS2</th><td>ITS-5.8S</td><td>GGGACGATGAAGAACGCAGC</td><td>47</td><td>White <i>et al</i>. (1990)</td></tr><tr><th></th><td>ITS-28S</td><td>TCCTCCGCTTATTGATATGC</td><td>47</td><td>White <i>et al</i>. (1990)</td></tr><tr><th>28S</th><td>28S-O</td><td>GAAACTGCTCAAAGGTAAACGG</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th></th><td>28S-C</td><td>GGTTCGATTAGTCTTTCGCC</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th><i>H3</i></th><td>H3aF</td><td>ATGGCTCGTACCAAGCAGACVGC</td><td>50</td><td>Colgan <i>et al</i>. (1998)</td></tr><tr><th></th><td>H3aR</td><td>ATATCCTTRGGCATRATRGTGAC</td><td>50</td><td>Colgan <i>et al</i>. (1998)</td></tr></tbody></table>
FIGURE 3 in On two Liphistius species (Araneae: Liphistiidae) from Laos
FIGURE 3. Liphistius isan, two males from Phou Asa (A–B, I, L; C–D, J), male holotype (K), male paratype (illustrated in original description; E–F) and four females from Phou Asa (M–P); L. dangrek, male holotype (G) and male paratype (illustrated in original description; H). A, distal part of left palp, ventral view. B–C, E, G, distal part of left palpal organ, slightly different ventral view. D, F, H, same of right palp. I–J, palpal organ, distal view. K, paracymbium, ventral view. L, tibial apophysis, retrolateral and slightly proximal view. M–P, vulva, ventral view. Scale lines 0.5 mm (A, M–P; B–F, I–L; G–H).
FIGURE 2 in On two Liphistius species (Araneae: Liphistiidae) from Laos
FIGURE 2. Liphistius isan, male (A, F) and female (B) from Phou Asa, Laos; L. laoticus sp. n., female allotype (C), male holotype (D); L. thoranie, male holotype (E). A–B, habitus. C–F, sternum and labium, ventral view.
FIGURE 1 in On two Liphistius species (Araneae: Liphistiidae) from Laos
FIGURE 1. Localities of mesothelid spiders in Indochina and the eastern parts of Thailand. Country boundaries are indicated in dotted lines, shorelines in entire thin lines, the Mekong River in an entire thick line. 1, Bolaven Plateau (Liphistius laoticus sp. n.). 2a, Phu Phan (L. isan, type locality); 2b, Sroi Sawan (L. isan); 2c, Phou Asa (L. isan). 3a, Phu Chong Nayoi (L. dangrek, type locality); 3b–d, L. dangrek. 4a, Nam Nao (L. pusohm, type locality; L. dangrek); 4b, Phu Kradung (L. pusohm). 5a, Khao Soi Dao (L. ornatus; type locality); 5b, L. ornatus. 6, Nam Tok Pliu (L. tenuis, type locality). 7, Ko Chang (L. nesioticus, type locality). 8, Ko Samet (L. phileion, type locality). 9, Huay Yang (L. albipes, type locality; L. bicoloripes). 10, Khao Khieo (L. sayam, type locality). 11, Khao Yai (L. suwat, L. thoranie, type localities). 12, Tham Suan Hin (actually Tham Lumphini Suan Hin; L. tham, type locality). 13, Thung Salaeng Luang (L. owadai, type locality). 14, Phu Hin Rongkla (L. onoi, type locality). 15, Phu Rua (L. ochraceus, type locality). 16, Sapa (Heptathela sapana, type locality). 17, Yen Bai (H. abca, type locality). 18, Tam Dao (H. tomokunii, type locality). 19, Luc Nam (H. tonkinensis, type locality). 20, Cuc Phuong (H. cucphuongensis, type locality). 21, Dalat (H. nui, type locality). 22, Bao Loc (H. australis, type locality). Other localities without numbers are of specimens which are not yet identified to species.
FIGURE 4 in On two Liphistius species (Araneae: Liphistiidae) from Laos
FIGURE 4. Liphistius laoticus sp. n., male holotype (A–E, I–J), three male paratypes (F–H), four female paratypes (N–Q; N is the "allotype"); L. thoranie, male paratype (illustrated in original description; K), holotype (M); L. ochraceus, male from type locality (L). A, distal part of left palp, ventral view. B, same, retrolateral view. C, same, retrodorsal view. D, M, distal part of palpal organ, slightly different ventral view. E–H, palpal organ, distal view. I, tibial apophysis, retrolateral and slightly proximal view. J–L, paracymbium, dorsal view. N–Q, vulva, ventral view. Scale lines 0.5 mm (A–D, M; E–H, J–L; I; N–Q).
Figure 7 from: Sivayyapram V, Kunsete C, Xu X, Smith DR, Traiyasut P, Deowanish S, Aung MM, Ono H, Li D, Warrit N (2024) Seven new species of the segmented spider genus Liphistius (Mesothelae, Liphistiidae) in Thailand and Myanmar. ZooKeys 1189: 203-229. https://doi.org/10.3897/zookeys.1189.115850
Figure 7 Liphistius kaengkhoi sp. nov. male palp and vulva plate A–D ARA-2018-284 (holotype) palp A prolateral view B ventral view C retrolateral view D distal view E, F ARA-2018-286 (allotype) vulva plate E ventral view F dorsal view. Abbreviations: CDO = central dorsal opening; CT = contrategulum; Cu = cumulus; de = distal edge of the contrategulum; Em = embolus; GA = genital atrium; mm = millimeter; PC = paracymbium; PeP = paraembolic plate; PP = poreplate; PS = posterior stalk; RC = receptacular cluster; ST = subtegulum; T = tegulum; TiA = tibial apophysis. Scale bar: 1 mm.
Figure 8 from: Sivayyapram V, Kunsete C, Xu X, Smith DR, Traiyasut P, Deowanish S, Aung MM, Ono H, Li D, Warrit N (2024) Seven new species of the segmented spider genus Liphistius (Mesothelae, Liphistiidae) in Thailand and Myanmar. ZooKeys 1189: 203-229. https://doi.org/10.3897/zookeys.1189.115850
Figure 8 Liphistius hintung sp. nov. A, B male ARA-2018-299 (holotype) C, D female, ARA-2018-296 (allotype) A, C dorsal view B, D lateral view. Scale bar: 10 mm.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.