Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

317

datasets available to search

ShareScore release 0.7.1

Reset

Dataset results

317 results for “embryogenesis”

Learn how ShareScore rates datasets ↗
zenodo28/100

Table 2 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

<p><b>Table 2</b> PCR primer sequences of selected somatic embryogenesis-related genes for qRT in pistachio.</p><table><tbody><tr><th>Gene name</th><th>Forward primer sequence 5&prime;-3&prime;</th><th>Reverse primer sequence 5&prime;-3&prime;</th><th>Tm (̊C)</th><th>Amplicon length (bp)</th></tr></tbody><tbody><tr><th><i>ACT</i></th><td>GTATCCACGAGACCACCTACA</td><td>GGAGCAACGACCTTGATCTTC</td><td>60</td><td>157</td></tr><tr><th><i>AGL15</i></th><td>GGAGCAATCAAGAGTACAGGAACAG</td><td>CACTTCAGGACTTGCAGAACTATGG</td><td>60</td><td>187</td></tr><tr><th><i>LEC</i></th><td>GATGTGGGGTCTCTTGGAAGGA</td><td>AGCCTGTTTTGCTTTACGAAATCTC</td><td>60</td><td>209</td></tr><tr><th><i>BBM</i></th><td>TCCCAATTAGCAACTACGAGAAAGAG</td><td>CTGATGATGCCTTGTAACACCAC</td><td>60</td><td>140</td></tr><tr><th><i>PKL</i></th><td>GTAGACATCGCACCCTCTTAACTG</td><td>GAGCCAGCATTTTATGAAGTCTTGA</td><td>60</td><td>174</td></tr></tbody></table>

opennotspecifiedMar 2019View details →
zenodo28/100

Table 1 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

<p><b>Table 1</b> Summary of different responses of zygotic immature embryos to different basal medium (BM1 and BM2), combination and concentration of plant growth regulators (PGRs), and light and dark conditions.The response of explants was in the form of callus (C), somatic embryogenesis (SE), and adventitious shoot (AS).The Basal media were BM1: MS mineral salts,B5 vitamins, 30 g L <i>&minus;</i> 1 sucrose, BM2: half strength MS macro salts, B5 vitamins, 100 mg L <i>&minus;</i> 1 L-glutamine, 500 mg L <i>&minus;</i> 1 casein hydrolysate, and 30 g L <i>&minus;</i> 1 sucrose.</p><table><tbody><tr><th>Coding</th><th>PGRs combinations (mg L <i>&minus;</i> 1)</th><th>Light</th><th>Dark</th></tr></tbody><tbody><tr><th></th><td></td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td></tr><tr><th></th><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td></tr><tr><th>E1</th><td>0</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E2</th><td>0.01 IBA</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E3</th><td>0.01 IBA + 1 BA</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E4</th><td>0.01 IBA + 2 BA</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E5</th><td>0.01 IBA + 3 BA</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E6</th><td>0.01 2,4-D</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E7</th><td>0.01 2,4-D + 0.1 TDZ</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E8</th><td>0.01 2,4-D + 0.25 TDZ</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E9</th><td>0.01 2,4-D + 0.5 TDZ</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E10</th><td>0.01 2,4-D + 1 TDZ</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E11</th><td>0.01 NAA</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E12</th><td>0.01 NAA + 1 BA</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td></tr><tr><th>E13</th><td>0.01 NAA + 2 BA</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td></tr><tr><th>E14</th><td>0.01 IBA + 0.1 TDZ</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E15</th><td>0.01 IBA + 0.25 TDZ</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E16</th><td>0.01 IBA + 0.5 TDZ</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td></tr><tr><th>E17</th><td>0.01 IBA + 1 TDZ</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>+</td><td>&ndash;</td><td>&ndash;</td></tr></tbody></table><p>&laquo;&ndash;&raquo; and &laquo; + &raquo; represent nonexistence and existence the response on explants that cultured in intended media, respectively.</p>

opennotspecifiedMar 2019View details →
zenodo28/100

Figure 13 in Comparative investigation of the late embryogenesis of Leptodora kindtii (Focke, 1844) (Crustacea: Branchiopoda), with notes on types of embryonic development and larvae in Cladocera

Figure 13. Change in length of an embryo of Leptodora kindtii throughout its development in vitro.

opennotspecifiedOct 2008View details →
zenodo28/100

Fig. 5 in Structural analysis of the Pimelodus maculatus (Lacépède, 1803) embryogenesis (Siluriformes: Pimelodidae)

Fig. 5. Histologicals sections of Pimelodus maculatus embryos in cleavage stage. a - with 2 cells, staining: HE, showing

opencc-by-4.0Dec 2011View details →
zenodo28/100

Fig. 8. a in Structural analysis of the Pimelodus maculatus (Lacépède, 1803) embryogenesis (Siluriformes: Pimelodidae)

Fig. 8. a - segmentation stage, showing the somites that will form the muscles; b - segmentation stage with formation of the

opencc-by-4.0Dec 2011View details →
zenodo28/100

Figure 8 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 8 - Oral disc in life of Hyperolius castaneus (Gosner Stage 40, from Karamba, ZFMK 97192) in overview (A) and close up view (B). Photos by M. Dehling.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 9 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 9 - Color variation in life of Hyperolius castaneus from Karamba (ZFMK 97192) at different Gosner stages. A Stage 35 B Stage 37 C Stage 38 D Stage 44. Photos by M. Dehling.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 7 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 7 - Tadpole of Hyperolius castaneus (Stage 29, ZFMK 97190) in lateral view (A) and oral disc (B). Drawings by E. Lehr.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 6 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 6 - Maximum likelihood phylogram of Rwandan species in the genus Hyperolius with Afrixalus quadivittatus, Leptopelis karissimbensis and Leptopelis cf. kivuensis 2 as outgroups, based on comparison of 548 base pairs of the mitochondrial 16S rRNA gene. Included are 42 adult specimens collected in southwestern Rwanda, samples taken from GenBank and five tadpoles representing the morphotypes collected in the Karamba and Uwasenkoko swamps (specimen identification in Appendix I). Numbers above nodes are percentage support values from maximum likelihood. Only values above 50% are shown.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 3 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 3 - A Hyperolius castaneus pair in amplexus at the Uwasenkoko swamp B Clutch laid in the transport box; 15 eggs attached to the upper container wall and 42 eggs within the water. For further details see text. Photos by U. Sinsch and M. Dehling.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 5 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 5 - Hatching of Hyperolius castaneus tadpoles from an egg mass attached 4 cm above water level. For further details see text. Photos by M. Dehling.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 14 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 14 - Color variation in life of Hyperolius jackie from Karamba (ZFMK 97194) at different Gosner stages. A Stage 36 B Stage 37 C Stage 40 D Stage 40. Photos by M. Dehling.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 2 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 2 - Hyperolius castaneus clutches of different age at the Uwasenkoko swamp. A Gelatinous clutch mass following hatching of tadpoles B Parasitized clutch mass with a few undeveloped eggs C Recently laid eggs attached to rush stalks. For further details see text. Photos by U. Sinsch.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 4 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 4 - Embryogenesis of a Hyperolius castaneus clutch at 20 ± 2 °C. A Egg mass 4 cm above water level 6h following oviposition B 5d following oviposition C 6d following oviposition D 7d following oviposition; two hatchlings of the upper egg mass and undeveloped eggs within water. For further details see text. Photos by M. Dehling.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 13 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 13 - Color variation in life of Hyperolius jackie from Karamba (ZFMK 97194) at different Gosner stages. A Stage 25 B Stage 30 C Stage 34 D Stage 35. Photos by M. Dehling.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 11 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 11 - Tadpole of Hyperolius jackie (Stage 32, ZFMK 97193) in lateral view (A) and oral disc (B). Drawings by E. Lehr.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 10 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 10 - Color variation in life of Hyperolius castaneus from Uwasenkoko (ZFMK 97191) at different Gosner stages. A Stage 25 B Stage 38 C Stage 41 D Stage 44. Photos by M. Dehling.

opencc-by-4.0Dec 2015View details →
zenodo28/100

Figure 1 from: Lehr E, Dehling J, Greenbaum E, Sinsch U (2015) Embryogenesis and tadpole description of Hyperolius castaneus Ahl, 1931 and H. jackie Dehling, 2012 (Anura, Hyperoliidae) from montane bog pools. ZooKeys 546: 125-152. https://doi.org/10.3897/zookeys.546.6044

Figure 1 - Tadpole habitats in the Nyungwe National Park. A Karamba swamp B Uwasenkoko swamp. For geographical details see Table 1. Photos by U. Sinsch.

opencc-by-4.0Dec 2015View details →
dryad28/100

Data from: A transgenic quail model that enables dynamic imaging of amniote embryogenesis

Open the record for dataset details and reuse information.

publicAug 2015View details →
dryad28/100

Data from: A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution

Open the record for dataset details and reuse information.

publicSep 2019View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record