Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

59

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

59 results for “mitochondrial COI”

Learn how ShareScore rates datasets ↗
zenodo28/100

Figure 5 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 5 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Lysiphlebus samples. Tested combinations of primers were: 1) LCO1490/Lys1Rd; 2) Aph2Fd/Lys2Rd; 3) Pr2Fd/Lys2Rd; and 4) Lys3Fd/HCO2198. The species included in trials were: LF1 - L. hirticornis; LF2 - L. cardui; and LF3 - L. fabarum; M – marker.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 4 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 4 Agarose gel visualizing the products of nested trials with products of direct PCR for samples PD12 - P. barbatum, PD14 - P. yomenae, and PD15 - P. yomenae. The products from PCR with Pr2Fd/Pr2Rd were submitted to secondary nested trials with primer pairs Pr2Fd/Pr2Rn and Aph2Fn/Pr2Rd. Amplicons obtained with Pr3Fd/HCO2198 were used as the template for nested reactions with Pr3Fd/Pr3Rn and Pr3Fn/HCO2198.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 1 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 1 Position of internal degenerative primers within the barcoding region of COI. Aphidius - specific primers: Aph1Fn, Aph1Rn, Aph1Rd, Aph2Fd, Aph2Fn, Aph2Rn, Aph2Rd, Aph3Fd, Aph3Fn and Aph3Rn; Lysiphlebus - specific primers: Lys1Fn, Lys1Rd, Lys2Fn, Lys2Rn, Lys2Rd, Lys3Fd and Lys3Fn; Praon - specific primers: Pr1Fn, Pr1Rn, Pr1Rd, Pr2Fd, Pr2Rn, Pr2Rd, Pr3Fd, Pr3Fn and Pr3Rn. Arrows refer to the direction of the primers, forward or reverse. The exact position of internal primers is designated in comparison to the first nucleotide of the forward LCO1490 primer sequence (5' GGTCAACAAATCATAAAGATATTGG 3').

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 2 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 2 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Aphidius samples. Three direct PCR reactions were conducted with the following primer pairs: 1 LCO1490/Aph1Rd 2 Aph2Fd/Aph2Rd; and 3 Aph3Fd/HCO2198. The species included in trials were: AF1- A. tanacetarius, AF2- A. sussi, AF3- A. sonchi, AF4- A. linosiphonis and AF5- A. ribis. M – marker.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 8 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 8 The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model. The tree with the highest log likelihood is shown. There were a total of 568 positions in the final dataset. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The percentage of replicate trees >50% in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 2 from: Qiao G, WANG J, Jiang L (2011) Use of a mitochondrial COI sequence to identify species of the subtribe Aphidina (Hemiptera, Aphididae). ZooKeys 122: 1-17. https://doi.org/10.3897/zookeys.122.1256

Figure 2 - Histogram of intra- and interspecific nucleotide divergence in Aphidina. Divergences were calculated by using Kimura's two parameter (K2P) model.

opencc-by-4.0Aug 2011View details →
zenodo28/100

Figure 1a from: Qiao G, WANG J, Jiang L (2011) Use of a mitochondrial COI sequence to identify species of the subtribe Aphidina (Hemiptera, Aphididae). ZooKeys 122: 1-17. https://doi.org/10.3897/zookeys.122.1256

Figure 1a - Neighbor-joining analysis of 198 specimens. It was based on COI sequence divergence in 591 bp of the COI gene using Kimura's two parameter model.

opencc-by-4.0Aug 2011View details →
zenodo28/100

Figure 1d from: Qiao G, WANG J, Jiang L (2011) Use of a mitochondrial COI sequence to identify species of the subtribe Aphidina (Hemiptera, Aphididae). ZooKeys 122: 1-17. https://doi.org/10.3897/zookeys.122.1256

Figure 1d - Neighbor-joining analysis of 198 specimens. It was based on COI sequence divergence in 591 bp of the COI gene using Kimura's two parameter model.

opencc-by-4.0Aug 2011View details →
zenodo28/100

Figure 1c from: Qiao G, WANG J, Jiang L (2011) Use of a mitochondrial COI sequence to identify species of the subtribe Aphidina (Hemiptera, Aphididae). ZooKeys 122: 1-17. https://doi.org/10.3897/zookeys.122.1256

Figure 1c - Neighbor-joining analysis of 198 specimens. It was based on COI sequence divergence in 591 bp of the COI gene using Kimura's two parameter model.

opencc-by-4.0Aug 2011View details →
zenodo28/100

Figure 1b from: Qiao G, WANG J, Jiang L (2011) Use of a mitochondrial COI sequence to identify species of the subtribe Aphidina (Hemiptera, Aphididae). ZooKeys 122: 1-17. https://doi.org/10.3897/zookeys.122.1256

Figure 1b - Neighbor-joining analysis of 198 specimens. It was based on COI sequence divergence in 591 bp of the COI gene using Kimura's two parameter model. * They were originally misidentified as Aphis asclepiadis Fitch; actually, should be Aphis nerii Boyer de Fonscolombe.

opencc-by-4.0Aug 2011View details →
zenodo28/100

Figure 1 from: Rakauskas R, Havelka J, Zaremba A (2013) Mitochondrial COI and morphological specificity of the mealy aphids (Hyalopterus ssp.) collected from different hosts in Europe (Hemiptera, Aphididae). ZooKeys 319: 255-267. https://doi.org/10.3897/zookeys.319.4251

Figure 1 - Maximum likelihood (ML) tree showing phylogenetic relationships among three Hyalopterus species based on partial sequences of mitochondrial COI (564 positions in final set). Numbers above branches indicate support of NJ (left) and MP (right) bootstrap test with 1000 replicates, and numbers below branches indicate support of ML (left) bootstrap test with 1000 replicates and posterior probabilities of BI analysis (right). Samples used for the discriminant analysis with a priori specified group membership followed by the construction of identification key are asterisked (*). The remaining samples were used for the post hoc classification. Sample numbers are the same as given in Table 1, together with the abbreviated symbol of respective country: BG Bulgaria, HU Hungary, LT Lithuania, RO Romania, SK Slovakia.

opencc-by-4.0Jul 2013View details →
zenodo28/100

Figure 3 from: Rakauskas R, Havelka J, Zaremba A (2013) Mitochondrial COI and morphological specificity of the mealy aphids (Hyalopterus ssp.) collected from different hosts in Europe (Hemiptera, Aphididae). ZooKeys 319: 255-267. https://doi.org/10.3897/zookeys.319.4251

Figure 3 - Dendrogram of hierarchical cluster analysis based on 17 morphological characters (squared Mahalanobis distances) using unweighted pair-group average linkage among 29 samples of Hyalopterus. Sample numbers the same as in Table 1. ar samples from Prunus armeniaca, d Prunus domestica, du Prunus dulcis, p Prunus persica, ph Phragmites communis.

opencc-by-4.0Jul 2013View details →
zenodo28/100

Figure 2 from: Rakauskas R, Havelka J, Zaremba A (2013) Mitochondrial COI and morphological specificity of the mealy aphids (Hyalopterus ssp.) collected from different hosts in Europe (Hemiptera, Aphididae). ZooKeys 319: 255-267. https://doi.org/10.3897/zookeys.319.4251

Figure 2 - Scatter-plot of the individual canonical scores of the first two canonical variates discriminating 21 samples of Hyalopterus collected from different host plants in five European countries (Bulgaria, Hungary, Lithuania, Romania, Slovakia).

opencc-by-4.0Jul 2013View details →
zenodo28/100

Figure 4 from: Rakauskas R, Havelka J, Zaremba A, Bernotienė R (2014) Mitochondrial COI and morphological evidence for host specificity of the black cherry aphids Myzus cerasi (Fabricius, 1775) collected from different cherry tree species in Europe (Hemiptera, Aphididae). ZooKeys 388: 1-15. https://doi.org/10.3897/zookeys.388.7034

Figure 4 - Plot of the mean scores of the individual LDF values (number of specimens per sample is given in Table 1) plotted against the mean body length for 30 samples of Myzus cerasi (normal font in Table 1) used to evaluate effectiveness of the eventual identification key. The icons are color-coded to match the COI haplotypes. Samples cluster in accordance with winter host plant and COI haplotype (haplotype number is given in parentheses, see Table 2 for haplotype information).

opencc-by-4.0Mar 2014View details →
zenodo28/100

Figure 1 from: Rakauskas R, Havelka J, Zaremba A, Bernotienė R (2014) Mitochondrial COI and morphological evidence for host specificity of the black cherry aphids Myzus cerasi (Fabricius, 1775) collected from different cherry tree species in Europe (Hemiptera, Aphididae). ZooKeys 388: 1-15. https://doi.org/10.3897/zookeys.388.7034

Figure 1 - Haplotype network (TCS 1.21 software: Clement et al. 2000) for COI fragment (616 positions in final set) haplotypes of Myzus cerasi and Myzus borealis. The haplotype with the highest outgroup probability is displayed as a square, while others are displayed as ovals. For sample information, see Table 2.

opencc-by-4.0Mar 2014View details →
zenodo28/100

Figure 3 from: Rakauskas R, Havelka J, Zaremba A, Bernotienė R (2014) Mitochondrial COI and morphological evidence for host specificity of the black cherry aphids Myzus cerasi (Fabricius, 1775) collected from different cherry tree species in Europe (Hemiptera, Aphididae). ZooKeys 388: 1-15. https://doi.org/10.3897/zookeys.388.7034

Figure 3 - Plot of the mean scores of the first two canonical variates for 20 samples of Myzus cerasi (for specimen numbers per sample see Table 1). Samples cluster in accordance with winter host plant and COI haplotype (haplotype number is given in parentheses, see Table 2 for other haplotypes).

opencc-by-4.0Mar 2014View details →
zenodo28/100

Figure 2 from: Rakauskas R, Havelka J, Zaremba A, Bernotienė R (2014) Mitochondrial COI and morphological evidence for host specificity of the black cherry aphids Myzus cerasi (Fabricius, 1775) collected from different cherry tree species in Europe (Hemiptera, Aphididae). ZooKeys 388: 1-15. https://doi.org/10.3897/zookeys.388.7034

Figure 2 - Maximum likelihood (ML) tree showing phylogenetic relationships among Myzus cerasi based on partial sequences of mitochondrial COI (616 positions in final set). Numbers above branches indicate support of NJ (left, > 50%) and MP (right, > 50%) bootstrap test with 1000 replicates, and numbers below branches indicate support of ML (left, > 50%) bootstrap test with 1000 replicates and posterior probabilities of BI analysis (right, > 0.50). Samples used for the discriminant analysis with a priori specified group membership followed by the construction of identification key are asterisked (*). The remaining samples were used for the post hoc classification. Sample numbers are the same as given in Table 1, together with the abbreviated symbol of respective country BG – Bulgaria, BY – Belarus, D – Germany, HU – Hungary, IT – Italy, LV – Latvia, LT – Lithuania, PL – Poland, RO – Romania, TR – Turkey, UA – Ukraine.

opencc-by-4.0Mar 2014View details →
zenodo20/100

Fig. 3 in Pauesia species (Hymenoptera: Braconidae: Aphidiinae) attacking Eulachnini aphids (Hemiptera: Aphididae: Lachninae) on coniferous plants in Lithuania: ecological and mitochondrial COI diversity

Fig. 3 Maximum likelihood tree of Pauesia species attacking Eulachnini aphids in Lithuania and samples identified as P. pini and P. juniperorum from GenBank based on partial COI sequences. Bootstrap test values for ML (left) and MP (middle), and BI posterior probabilities (right) are indicated. For details, see Supplementary Fig. 1

opennotspecifiedAug 2021View details →
zenodo20/100

Fig. 1 in Pauesia species (Hymenoptera: Braconidae: Aphidiinae) attacking Eulachnini aphids (Hemiptera: Aphididae: Lachninae) on coniferous plants in Lithuania: ecological and mitochondrial COI diversity

Fig. 1 Sites of aphid collection in 2018–2019 in four Climatic regions of Lithuania. Locali- ties where parasitoids were also found are shown as black circles. 1—Coastal, 2—Samogitian, 3—Middle Lithuanian lowland, 4—Southeastern highlands

opennotspecifiedAug 2021View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record