Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
1,054
datasets available to search
ShareScore release 0.7.1
Dataset results
1,054 results for “Auchenorrhyncha”
TABLE 1 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
<p><b>TABLE 1.</b> Primers used to amplify loci used for assessment of <i>Shellenius serratus</i> <b>sp. nov.</b> and corresponding annealing temperatures and extension times.</p><table><tbody><tr><th>Primer Name</th><th>Gene</th><th>Sequence (5’→3’)</th><th>Annealing</th><th>Extension</th><th>Reference</th></tr></tbody><tbody><tr><th>LCO1490 HCO2198</th><td>COI</td><td>GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA</td><td>40˚C</td><td>1 min. 30 sec.</td><td>Folmer <i>et al.</i> 1994</td></tr><tr><th>18SACDN_F1 18SACDN_R1</th><td>18S</td><td>AGAGGGAGCCTGAGAAACG GGGCAGGGACGTAATCAAC</td><td>60˚C</td><td>1 min. 45 sec.</td><td>Bahder <i>et al.</i> 2023</td></tr><tr><th>V/Forward X/Reverse</th><td>28S</td><td>GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC</td><td>55°C</td><td>1 min. 30 sec.</td><td>Cryan <i>et al.</i> 2000</td></tr></tbody></table>
FIGURE 8 in Description of larval instars of Dryinus tarraconensis Marshall, 1868 and Gonatopus baeticus (Ceballos, 1927) (Hymenoptera: Chrysidoidea: Dryinidae), parasitoids of the genus Dictyophara Germar (Hemiptera: Auchenorrhyncha: Dictyopharidae)
FIGURE 8. Gonatopus baeticus (Ceballos), mature larva. A. Head, dorsal view. B. Labrum. C. Sensilla of epipharynx. D. Labium, ventral view. E. Antenna. F. Right maxillary palp, ventral view. G. Thoracic spiracle, from outside. H. Thoracic spiracle, lateral view.
FIGURES 1–3 in A new species of the genus Grammacephalus Haupt (Hemiptera:Auchenorrhyncha Cicadellidae: Deltocephalinae) from the United Arab Emirates, with a key to species of the genus known from the Arabian Peninsula
FIGURES 1–3. Grammacephalus albatus sp. nov., holotype. 1—dorsal view; 2—lateral view; 3—face. Total length of the specimen—4.0 mm.
FIGURES 4–11 in A new species of the genus Grammacephalus Haupt (Hemiptera:Auchenorrhyncha Cicadellidae: Deltocephalinae) from the United Arab Emirates, with a key to species of the genus known from the Arabian Peninsula
FIGURES 4–11. Grammacephalus albatus sp. nov., 4–9—holotype, male genitalia, 10, 11—female paratype, sternite VII, ventral view. 4—anal tube and pygofer, lateral view; 5—genital valve and subgenital plates, ventral view; 6—aedeagus and connective, lateral view; 7—same, ventral view; 8—connective, dorsal view; 9—style, ventral view; 10—specimen from Dadna; 11—specimen from Wadi Wurayah.
FIGURES 10–16. Scaphoideus species. 10–12, S. rubroguttatus, 10–11 in Three new Old World species of the leafhopper genus Scaphoideus Uhler (Hemiptera: Auchenorrhyncha: Cicadellidae)
FIGURES 10–16. Scaphoideus species. 10–12, S. rubroguttatus, 10–11, aedeagus (left lateral and posterior, respectively), 12, style; 13–14, S. unimaculata, aedeagus (left lateral and posterior, respectively). 15–16, S. quangtriensis, aedeagus, left lateral and posterior view, respectively).
FIGURES 17–22 in Three new Old World species of the leafhopper genus Scaphoideus Uhler (Hemiptera: Auchenorrhyncha: Cicadellidae)
FIGURES 17–22. Scaphoideus species (habitus). 17, S. unimaculatus (holotype); 18, S. quangtriensis (holotype); 19, S. rubroguttatus; 20, S. dellagiustinai (paratype, France); 21, S. baeiticus (holotype); 22, S. albosignatus (syntype).
FIGURES 1–9. Scaphoideus dellagiustinai, 1, 2 in Three new Old World species of the leafhopper genus Scaphoideus Uhler (Hemiptera: Auchenorrhyncha: Cicadellidae)
FIGURES 1–9. Scaphoideus dellagiustinai, 1, 2, head and thorax (dorsal and lateral view, respectively); 3, face; 4, style; 5, connective; 6, 7 aedeagus (left lateral and posterior view, respectively); 8, male genital capsule; 9, valve, subgenital plates (ventral left, dorsal right) and style.
Figure 1 in Two new Encarsia species (Hymenoptera: Aphelinidae) reared from eggs of Cicadellidae (Hemiptera: Auchenorrhyncha) in Argentina: an unusual new host association
Figure 1. Encarsia dalbulae sp. nov. (A) Head; (B) dorsal mesosoma; (C) forewing; (D) male genitalia; (E) antenna. Scale bars: 0.1 mm.
Figure 3 in Two new Encarsia species (Hymenoptera: Aphelinidae) reared from eggs of Cicadellidae (Hemiptera: Auchenorrhyncha) in Argentina: an unusual new host association
Figure 3. Encarsia mollicellae sp. nov. (A) Head; (B) dorsal mesosoma; (C) male genitalia; (D) mandibles; (E) details of antenna (arrows indicate sensilla); (F) antennae.
FIGURE 2 in Taxonomic revision of the genus Waigara Zhang & Webb (Hemiptera: Auchenorrhyncha: Cicadellidae: Deltocephalinae: Drabescini) with description of a new species from Korea
FIGURE 2. Waigara planstyla sp. nov.. A. Male habitus, dorsal view; B. Ditto, lateral view; C. Genital segment (anal tube, pygofer lobe, aedeagus, subgenital plate and style), lateral view; D. Pygofer lobe, lateral view; E. Profemur, lateral view; F. Style, dorsal view; G. Subgenital plate, dorsal view; H. Aedeagus and Connective, lateral view; I. same, ventral view; J. Connective, dorsal view; Scale bars: (A–B) 1 mm; (C–H) 0.1 mm.
FIGURE 1 in Taxonomic revision of the genus Waigara Zhang & Webb (Hemiptera: Auchenorrhyncha: Cicadellidae: Deltocephalinae: Drabescini) with description of a new species from Korea
FIGURE 1. Waigara boninensis (Matsumura, 1914) Lectotype male. A. Male habitus, dorsal view; B. Ditto, lateral view; C. Pygofer lobe, lateral view; D. Style, dorsal view; E. Subgenital plate and style, dorsal view; F. Aedeagus and connective, lateral view; G. Ditto, ventral view; H. Connective, dorsal view. Scale bars: (A–B) 1 mm; (C–H) 0.1 mm.
FIG. 7 in New species, synonymies and life-histories in the South-East Asian treehopper genus Pyrgauchenia Breddin (Auchenorrhyncha: Membracidae: Centrotinae)
FIG. 7. Nymphs of Pyrgauchenia tristaniopsis. (A, B) First instar: (A) habitus left lateral view, rostrum and legs not drawn; (B) apex of abdomen, dorsal view. (C, D) second instar, ditto. (E, F) Third instar, ditto. (G, H) Fourth instar, ditto. (I, J) Fifth instar: (I) apex of abdomen; (J) habitus, left lateral view, rostrum and legs not drawn. (K) Pronotum left lateral view (®fth instar female, for arrow see text). (L) Head and thorax, dorsal view (®fth instar). 1st, 2nd, 3rd Instars and 4th±5th Instars drawn to scale, respectively.
FIG. 4 in New species, synonymies and life-histories in the South-East Asian treehopper genus Pyrgauchenia Breddin (Auchenorrhyncha: Membracidae: Centrotinae)
FIG. 4. Pyrgauchenia colorata. (A± C) Aedeagus, posterior, apical and left lateral view, respectively (broken line in (C) indicates gonoduct on posterior side and median groove on anterior side). (D) Left style in lateral view (broken line indicates membrane connecting styles). (E) Left style, posterior view, i.e. as indicated by arrowhead in ®gure 2I, line indicates median plane.
FIG. 3 in New species, synonymies and life-histories in the South-East Asian treehopper genus Pyrgauchenia Breddin (Auchenorrhyncha: Membracidae: Centrotinae)
FIG. 3. External features in Pyrgauchenia colorata. (A± C) Habitus, right lateral and frontal view: (A) brunnei paratype male; (B) male leg. U. Stegmann; (C) colorata paralectotype female. (D, E) Distal lobes of anterior process of pronotum, anterodorsal and left lateral view respectively, male leg. U. Stegmann (dotted and solid line, respectively: median carina). (F±H) Habitus female, right lateral and frontal view: (F) colorata lectotype; (G) angulata paratype; (H) leg. U. Stegmann. (I) Female pronotum, left lateral view, leg. U. Stegmann. (J) Apex of anterior process of female, posterior view, leg. U. Stegmann.
FIG. 1 in New species, synonymies and life-histories in the South-East Asian treehopper genus Pyrgauchenia Breddin (Auchenorrhyncha: Membracidae: Centrotinae)
FIG. 1. External features and genitalia in Pyrgauchenia species, left lateral view, except where indicated (for arrows see text). (A±F) tristaniopsis: (A) head, frontal view; (B) left tegmina; (C) male genital capsule; (D) subgenital plates, ventral view; (E) 2nd valvulae; (F) female genital capsule. (G±H) biuni: left side of pronotum of last instar nymph, (G) female; (H) male. (I±K) colorata, last instar nymph: (I) pronotum of female; (J) pronotum of male; (K) abdominal apex in dorsal view. (L, M) pendleburyi, pronotum of last instar nymph: (L) female; (M) male.
FIG. 2 in New species, synonymies and life-histories in the South-East Asian treehopper genus Pyrgauchenia Breddin (Auchenorrhyncha: Membracidae: Centrotinae)
FIG. 2. Pyrgauchenia biuni (paratypes unless stated otherwise) (for arrows and arrowhead see text). (A) Habitus male, right lateral and frontal view (marked distance indicates length of anterior process). (B) Habitus female, right lateral and frontal view. (C) Distal lobes of male anterior process, anterodorsal view (dotted line: median carina). (D) Distal lobes of male anterior process, left lateral view. (E) Distal lobes of female anterior process, anterodorsal view. (F±H) Aedeagus, posterior (right: holotype), left lateral and apical view respectively (broken line in (G) indicates gonoduct on posterior side and median groove on anterior side). (I) Left style, left lateral view (upper: holotype) (broken line indicates membrane connecting the styles; marked distance with arrowhead indicates perspective of (J )). (J) Left style in posterior view, as indicated by arrowhead in (I) (left: holotype) (line indicates median plane).
Figure 6 in Taxonomic review of the genus Scaphoideus Uhler (Hemiptera: Auchenorrhyncha: Cicadellidae: Deltocephalinae) from Korea, with description of one new species
Figure 6. Female sternite VII and valvulae. (a–e) Sternite VII, ventral view; (f,i,l,o,r) apical half of first valvulae, lateral view; (g,j,m,p,s) apical half of second valvulae, lateral view; (h,k,n,q,t) apical half of third valvulae, lateral view; (a,f–h) Scaphoideus albovittatus; (b,i–k) Scaphoideus festivus; (c,l–n). Scaphoideus varius; (d,o–q) Scaphoideus rubroguttatus; (e,r–t) Scaphoideus yeongdongensis sp. nov.
Figure 5 in Taxonomic review of the genus Scaphoideus Uhler (Hemiptera: Auchenorrhyncha: Cicadellidae: Deltocephalinae) from Korea, with description of one new species
Figure 5. Scaphoideus yeongdongensis sp. nov. (a) Male habitus dorsal view; (b) male habitus, in lateral view; (c) face, frontal view; (d) style, dorsal view; (e) genital segment (anal tube, pygofer lobe, aedeagus, subgenital plate and style), lateral view; (f) aedeagus, caudal view; (g) aedeagus, lateral view; (h) subgenital plate, ventral view; (i) connective, dorsal view; (j) connective, lateral view. Scale bars: a–c = 1 mm; d–j = 0.1 mm.
Figure 3. Scaphoideus varius Vilbaste, 1968 in Taxonomic review of the genus Scaphoideus Uhler (Hemiptera: Auchenorrhyncha: Cicadellidae: Deltocephalinae) from Korea, with description of one new species
Figure 3. Scaphoideus varius Vilbaste, 1968. (a) Male habitus dorsal view; (b) male habitus, in lateral view; (c) face, frontal view; (d) style, dorsal view; (e) pygofer lobe, lateral view; (f) aedeagus, caudal view; (g) aedeagus, lateral view; (h) subgenital plate, ventral view; (i) connective, dorsal view; (j) connective, lateral view. Scale bars: a–c = 1 mm; d–j = 0.1 mm.
Figure 5 in Diversity and temporal variations of the leafhopper fauna (Cicadellidae, Auchenorrhyncha, Hemiptera) in two ecological zones of Egypt
Figure 5. Seasonal fluctuations of the mean monthly temperature and relative humidity in Qena and Alexandria governorates throughout 2018. SE: standard error.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.