Find research datasets worth reusing

opennotspecifiedMay 2020View details →

FIGURE 1 in Pacifigeron indivisus (Asteraceae: Astereae), a new species endemic to Rapa, Austral Islands, and a new delimitation of the Celmisia group

FIGURE 1. Distribution map of Rapa, the Celmisia group, and some of the genera discussed in the text. Inset: Pacifigeron rapensis (circles) and P. indivisus (triangles). Distribution of other South American genera mentioned in the text are almost totally included within the distributions of Diplostephium and Linochilus. Laennecia is also distributed in southwestern USA and Mexico.

opennotspecifiedMay 2020View details →

FIGURE 3. Pacifigeron indivisus. A. Capitulum. B in Pacifigeron indivisus (Asteraceae: Astereae), a new species endemic to Rapa, Austral Islands, and a new delimitation of the Celmisia group

FIGURE 3. Pacifigeron indivisus. A. Capitulum. B. Terminal capitulescence of many clustered capitula. C. Habit. P. rapensis. D. A few individuals (note the terminal capitulescences of few capitula). E. Habit. Photographs: A by Kenneth R. Wood, B–E by Jean-Yves Meyer.

opennotspecifiedNov 2023View details →

Table 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Table 2. Primers used and their annealing temperatures.<table><tbody><tr><th>Gene</th><th>Primer</th><th>Sequence (5 ʹ –3 ʹ)</th><th>Annealing temperature (°C)</th><th>Reference</th></tr></tbody><tbody><tr><th>CO1</th><td>LCO1490</td><td>GGTCAACAAATCATAAAGATATTGG</td><td>40</td><td>Folmer et al. (1994)</td></tr><tr><th></th><td>HCO2198</td><td>TAAACTTCAGGGTGACCAAAAAATCA</td><td>40</td><td>Folmer et al. (1994)</td></tr><tr><th>16S</th><td>16Sar</td><td>ATAGAGCTCCCATGGCGCCTGTTTAT CAAAAACAT</td><td>54</td><td>Huber et al. (1993)</td></tr><tr><th></th><td>16Sbr</td><td>ATAGAGCTCCCATGGCCGGTCTGAA CTCAGATCACGT</td><td>54</td><td>Huber et al. (1993)</td></tr><tr><th>ITS2</th><td>ITS-5.8S</td><td>GGGACGATGAAGAACGCAGC</td><td>47</td><td>White et al. (1990)</td></tr><tr><th></th><td>ITS-28S</td><td>TCCTCCGCTTATTGATATGC</td><td>47</td><td>White et al. (1990)</td></tr><tr><th>28S</th><td>28S-O</td><td>GAAACTGCTCAAAGGTAAACGG</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th></th><td>28S-C</td><td>GGTTCGATTAGTCTTTCGCC</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th>H3</th><td>H3aF</td><td>ATGGCTCGTACCAAGCAGACVGC</td><td>50</td><td>Colgan et al. (1998)</td></tr><tr><th></th><td>H3aR</td><td>ATATCCTTRGGCATRATRGTGAC</td><td>50</td><td>Colgan et al. (1998)</td></tr></tbody></table>

opencc-zeroDec 2016View details →

Data from: A synopsis of the saddle fungi (Helvella: Ascomycota) in Europe – species delimitation, taxonomy and typification

Helvella is a widespread, speciose genus of large apothecial ascomycetes (Pezizomycete: Pezizales) that are found in terrestrial biomes of the Northern and Southern Hemispheres. This study represents a beginning on assessing species limits and applying correct names for Helvella species based on type material and specimens in the university herbaria (fungaria) of Copenhagen (C), Harvard (FH) and Oslo (O). We use morphology and phylogenetic evidence from four loci – heat shock protein 90 (hsp), translation elongation factor alpha (tef), RNA polymerase II (rpb2) and the nuclear large subunit ribosomal DNA (LSU) –to assess species boundaries in an expanded sample of Helvella specimens from Europe. We combine the morphological and phylogenetic information from 55 Helvella species from Europe with a small sample of Helvella species from other regions of the world. Little intraspecific variation was detected within the species using these molecular markers; hsp and rpb2 markers provided useful barcodes for species delimitaion in this genus, while LSU provided more variable resolution among the pertinent species. We discuss typification issues and identify molecular characteristics for 55 European Helvella species, designate neo- and epitypes for 30 species, and describe seven Helvella species new to science, i.e., H. alpicola, H. alpina, H. carnosa, H. danica, H. nannfeldtii, H. pubescens and H. scyphoides.

opencc-zeroDec 2013View details →

Data from: Use of RAD sequencing for delimiting species

RAD-tag sequencing is a promising method for conducting genome-wide evolutionary studies. However, to date, only a handful of studies empirically tested its applicability above the species level. In this communication, we use RAD tags to contribute to the delimitation of species within a diverse genus of deep-sea octocorals, Chrysogorgia, for which few classical genetic markers have proved informative. Previous studies have hypothesized that single mitochondrial haplotypes can be used to delimit Chrysogorgia species. On the basis of two lanes of Illumina sequencing, we inferred phylogenetic relationships among 12 putative species that were delimited using mitochondrial data, comparing two RAD analysis pipelines (Stacks and PyRAD). The number of homologous RAD loci decreased dramatically with increasing divergence, as >70% of loci are lost when comparing specimens separated by two mutations on the 700-nt long mitochondrial phylogeny. Species delimitation hypotheses based on the mitochondrial mtMutS gene are largely supported, as six out of nine putative species represented by more than one colony were recovered as discrete, well-supported clades. Significant genetic structure (correlating with geography) was detected within one putative species, suggesting that individuals characterized by the same mtMutS haplotype may belong to distinct species. Conversely, three mtMutS haplotypes formed one well-supported clade within which no population structure was detected, also suggesting that intraspecific variation exists at mtMutS in Chrysogorgia. Despite an impressive decrease in the number of homologous loci across clades, RAD data helped us to fine-tune our interpretations of classical mitochondrial markers used in octocoral species delimitation, and discover previously undetected diversity.

opencc-zeroDec 2011View details →

Data from: Species delimitation with ABC and other coalescent-based methods: a test of accuracy with simulations and an empirical example with lizards of the Liolaemus darwinii complex (Squamata: Liolaemidae)

Species delimitation is a major research focus in evolutionary biology because accurate species boundaries are a prerequisite for the study of speciation. New species delimitation methods (SDMs) can accommodate non-monophyletic species and gene tree discordance as a result of incomplete lineage sorting via the coalescent model, but do not explicitly accommodate gene flow after divergence. Approximate Bayesian Computation (ABC) can incorporate gene flow and estimate other relevant parameters of the speciation process while testing alternative species delimitation hypotheses. We evaluated the accuracy of BPP, SpeDeSTEM, and ABC for delimiting species using simulated data and applied these methods to empirical data from lizards of the Liolaemus darwinii complex. Overall, BPP was the most accurate, ABC showed an intermediate accuracy, and SpeDeSTEM was the least accurate under most simulated conditions. All three SDMs showed lower accuracy when speciation occurred despite gene flow, as found in previous studies, but ABC was the method with the smallest decrease in accuracy. All three SDMs consistently supported the distinctness of southern and northern lineages within L. darwinii. These SDMs based on genetic data should be complemented with novel SDMs based on morphological and ecological data to achieve truly integrative and statistically robust approaches to species discovery.

opencc-zeroJun 2021View details →

Evaluating species delimitation methods in radiations: The land snail Albinaria cretensis complex on Crete

Delimiting species in radiations is notoriously difficult because of the small differences between the incipient species, the star-like tree with short branches between species, incomplete lineage sorting, and the possibility of introgression between several of the incipient species. Next generation sequencing data may help to overcome some of these problems. We evaluated methods for species delimitation based on genome-wide markers in a land snail radiation on Crete. Species delimitation in the Albinaria cretensis group was based exclusively on shell characters until now and resulted in classifications distinguishing 3–9 species. We generated sequences of 4270 loci for 140 specimens of the Albinaria cretensis group from 48 populations by double-digest restriction site-associated DNA sequencing. We evaluated three methods for species discovery. The multispecies coalescent approach implemented in the program Bayesian Phylogenetics and Phylogeography resulted in a drastic overestimating of the number of species, whereas Gaussian clustering resulted in an overlumping. Primary species hypotheses based on the maximum percentage of the genome of the individuals derived from ancestral populations as estimated with the program ADMIXTURE moderately overestimated the number of species, but this was the only approach that provided information about gene flow between groups. Two of the methods for species validation that we applied, BFD* and delimitR, resulted in an acceptance of almost all primary species hypotheses, even such based on arbitrary subdivisions of hypotheses based on ADMIXTURE. In contrast, secondary species hypotheses, resulting from an evaluation of primary species hypotheses based on ADMIXTURE with isolation by distance tests, approached the morphological classification, but also uncovered two cryptic species and indicated that some of the previously delimited units should be combined. Thus, we recommend this combination of approaches that provided more detailed insights in the distinctness of barriers between the taxa of a species complex and the spatial distribution of admixture between them than the other methods. The recognition and delimitation of undersampled species remained a major challenge.

FIGURE 2 in Species delimitation and name application in Deyeuxia abnormis, Agrostis zenkeri, A. pleiophylla and related taxa (Poaceae: Agrostidinae)

FIGURE 2. Box plots of selected characters showing mean (point), mean ± SD (box), and range of variation (bars) for Deyeuxia abnormis (abno), D. diffusa (diff), D. flaccida (flac), A. gigantea (gig), A. pleiophylla (plei) and A. zenkeri (zenk).

FIGURE 7 in Species delimitation and name application in Deyeuxia abnormis, Agrostis zenkeri, A. pleiophylla and related taxa (Poaceae: Agrostidinae)

FIGURE 7. The first syntype of Agrostis pleiophylla, Clarke 44736B (B). The left-hand specimen (covered by the label attached to the upper left-hand corner of the sheet) and the right-hand specimen are identified as Deyeuxia diffusa. The middle specimen is recognized as Agrostis pleiophylla.

FIGURE 6 in Species delimitation and name application in Deyeuxia abnormis, Agrostis zenkeri, A. pleiophylla and related taxa (Poaceae: Agrostidinae)

FIGURE 6. Inflorescence of Deyeuxia diffusa (CHINA: NW Yunnan, ca. 12 km E of Zhongdian (Shangrila), photograph: Beata Paszko).

FIGURE 4. Glumes and floret. A–B in Species delimitation and name application in Deyeuxia abnormis, Agrostis zenkeri, A. pleiophylla and related taxa (Poaceae: Agrostidinae)

FIGURE 4. Glumes and floret. A–B. Deyeuxia abnormis, Ohba et al. 62069 (TI); C–D. Deyeuxia diffusa, Kanai et al. 6302070 (TI). Scale bar = 1 mm.

FIGURE 3 in Species delimitation and name application in Deyeuxia abnormis, Agrostis zenkeri, A. pleiophylla and related taxa (Poaceae: Agrostidinae)

FIGURE 3. Lectotype of Deyeuxia abnormis designated by Bor (1954a) (K). Reproduced with permission from the Board of the Trustees of the RBG, Kew.

FIGURE 1 in Species delimitation and name application in Deyeuxia abnormis, Agrostis zenkeri, A. pleiophylla and related taxa (Poaceae: Agrostidinae)

FIGURE 1. Scatter plot of two ratios: callus hairs to lemma length against palea to lemma length, for Deyeuxia abnormis (open circles), D. diffusa (solid squares), D. flaccida (asterisks), Agrostis gigantea (open triangles), A. pleiophylla (solid triangles) and A. zenkeri (solid circle). Abbreviations: 1, Aulacolepis petelotii—holotype; 2, Anisachne gracilis—epitype selected in the present study; 3, Deyeuxia abnormis—lectotype selected by Bor (1954a); 4, Agrostis continentalis—lectotype selected in the present study; 5, A. zenkeri—holotype; 6, A. pleiophylla—lectotype selected by Noltie (1999); 7, Deyeuxia abnormis—lectotype selected by Noltie (1999); 8, D. diffusa—holotype; 9, D. flaccida—holotype; 10, Agrostis nagensis—holotype; 11, A. pleiophylla—lectotype selected in the present study.

opennotspecifiedMar 2008View details →

FIGURE 3 in Species delimitation in the Drosophila aldrichi subcluster (Diptera: Drosophilidae) using DNA sequences

FIGURE 3. Distribution map of the samples used in the molecular analysis. Specimens collected in Australia are not shown.

opennotspecifiedMar 2008View details →

FIGURE 1 in Species delimitation in the Drosophila aldrichi subcluster (Diptera: Drosophilidae) using DNA sequences

FIGURE 1. Strict consensus tree of 54 most parsimonious trees in the combined analysis of all four genes – length = 693; CI = 0.693; RI = 0.718; RC = 0.497. Decay index is shown above the nodes. Numbers below the nodes are Bootstrap / Jackknife support values higher than 50 %. Each node is identified by a letter to relate with Fig. 2. The smaller cladogram highlights branching and support values for the ingroup.

opennotspecifiedMar 2008View details →

FIGURE 2 in Species delimitation in the Drosophila aldrichi subcluster (Diptera: Drosophilidae) using DNA sequences

FIGURE 2. (A) Strict consensus tree of 700 most parsimonious trees in the combined mtDNA analysis – length = 479; CI = 0.683; RI = 0.753; RC = 0.514. Decay index is shown above the nodes. Bootstrap / Jackknife support values are presented below the node. Each node is identified by a letter to relate with Fig. 1. The smaller cladogram highlights branching and support values in for the ingroup. (B) Strict consensus tree of 13288 most parsimonious trees in the combined nuclear analysis – length = 194; CI = 0.789; RI = 0.606; RC = 0.563. Decay index is shown above the nodes. Bootstrap / Jackknife support values are presented below the node. Each node is identified by a letter to relate with Fig. 1.

opencc-zeroJul 2021View details →

Data from: Phylogenomic species delimitation dramatically reduces species diversity in an Antarctic adaptive radiation

Application of genetic data to species delimitation often builds confidence in delimitations previously hypothesized using morphological, ecological, and geographic data and frequently yields recognition of previously-undescribed cryptic diversity. However, a recent critique of genomic data-based species delimitation approaches is that they have the potential to conflate population structure with species diversity, resulting in taxonomic oversplitting. The need for an integrative approach to species delimitation, in which molecular, morphological, ecological, and geographic lines of evidence are evaluated together, is becoming increasingly apparent. Here, we integrate phylogenetic, population genetic, and coalescent analyses of genome-wide sequence data with investigation of variation in multiple morphological traits to delimit species within the Antarctic barbeled plunderfishes (Artedidraconidae: Pogonophryne). Pogonophryne currently comprises 29 valid species, most of which are distinguished solely by variation in ornamentation of the mental barbel that projects from the lower jaw, a structure previously shown to vary widely within a single species. However, our genomic and phenotypic analyses result in a dramatic reduction in the number of distinct species recognized within the clade, providing evidence to support the recognition of no more than six species. We propose to synonymize 24 of the currently recognized species with five species of Pogonophryne. We find genomic and phenotypic evidence for a new species of Pogonophryne from specimens collected in the Ross Sea. Our findings represent a rare example in which application of molecular data provides evidence of taxonomic oversplitting on the basis of morphology, clearly demonstrating the utility of an integrative species delimitation framework.

opennotspecifiedJul 2008View details →

FIGURE 2 in The Cheilosia canicularis group (Diptera: Syrphidae): species delimitation and evolutionary relationships based on wing geometric morphometrics

FIGURE 2. The locations of ten landmarks on a right wing of the C. canicularis group selected for geometric morphometric analysis.

opennotspecifiedJul 2008View details →

FIGURE 6 in The Cheilosia canicularis group (Diptera: Syrphidae): species delimitation and evolutionary relationships based on wing geometric morphometrics

FIGURE 6. Boxplot of centroid size of species of the C. canicularis group with the mean, standard error and standard deviation illustrating sexual size dimorphism.