Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

1,551

datasets available to search

ShareScore release 0.7.1

Reset

Dataset results

1,551 results for “Availability”

Learn how ShareScore rates datasets ↗
zenodo32/100

FIGURE 4 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 4. Forewing venation of Platocerella sordida sp. nov.; black text = vein and italic text = crossvein.

opennotspecifiedSep 2024View details →
zenodo32/100

FIGURE 3 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 3. Adult male of Platocerella sordida sp. nov.; A) dorsal view of head, pronotum and mesonotum, B) lateral view of head, pronotum and mesonotum and C) frontal view of head; scale bar = 1 mm.

opennotspecifiedSep 2024View details →
zenodo32/100

FIGURE 6 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 6. Aedeagus of Platocerella sordida sp. nov.; A) right lateral view, B) left lateral view, C) dorsal view, and D) ventral view.

opennotspecifiedSep 2024View details →
zenodo32/100

FIGURE 5 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 5. Adult male genitalia of Platocerella sordida sp. nov.; A) left lateral view, B) ventral view, and C) dorsal view.

opennotspecifiedSep 2024View details →
zenodo32/100

TABLE 1 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

<p><b>TABLE 1.</b> Primers used to amplify loci used for assessment of <i>Shellenius serratus</i> <b>sp. nov.</b> and corresponding annealing temperatures and extension times.</p><table><tbody><tr><th>Primer Name</th><th>Gene</th><th>Sequence (5&rsquo;&rarr;3&rsquo;)</th><th>Annealing</th><th>Extension</th><th>Reference</th></tr></tbody><tbody><tr><th>LCO1490 HCO2198</th><td>COI</td><td>GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA</td><td>40&ring;C</td><td>1 min. 30 sec.</td><td>Folmer <i>et al.</i> 1994</td></tr><tr><th>18SACDN_F1 18SACDN_R1</th><td>18S</td><td>AGAGGGAGCCTGAGAAACG GGGCAGGGACGTAATCAAC</td><td>60&ring;C</td><td>1 min. 45 sec.</td><td>Bahder <i>et al.</i> 2023</td></tr><tr><th>V/Forward X/Reverse</th><td>28S</td><td>GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC</td><td>55&deg;C</td><td>1 min. 30 sec.</td><td>Cryan <i>et al.</i> 2000</td></tr></tbody></table>

opennotspecifiedSep 2024View details →
zenodo32/100

A green solvent enables precursor phase engineering of stable formamidinium lead triiodide perovskite solar cells - Data Availability

<p>A green solvent enables precursor phase engineering of stable formamidinium lead triiodide perovskite solar cells - Data Availability</p>

opencc-by-4.0Oct 2024View details →
zenodo32/100

Metal limiting habitability in Enceladus? Availability of trace metals for methanogenic life in hydrothermal fluids [Dataset]

<p>All measurement and calculation data are uploaded.</p> <p>Version 4 was uploaded on 2024-11-06 for revision.</p> <p>The file name "T24_calculation_data_Fig9_Fig10.xlsx" and a description in the file for Figure 9 have been modified in order to correctly correspond to the figure. *The previous file name "T24_calculation_data_Fig8_Fig10.xlsx".</p>

opencc-by-4.0Jun 2024View details →
zenodo32/100

Constraints on global mined geological resource production from limited regional water availability

<p>This depository provides the input dataset and codes/analytical procedures required to assess the sustainable capacity of mineral production considering local water resources as a constraint. The output dataset derived from the study are also provided.</p>

opencc-by-4.0Nov 2024View details →
dryad32/100

Data from: Food availability modulates differences in parental effort between dispersing and philopatric birds

Dispersal entails costs and might have to be traded off against other life-history traits. Dispersing and philopatric individuals may thus exhibit alternative life-history strategies. Importantly, these differences could also partly be modulated by environmental variation. Our previous results in a patchy population of a small passerine, the collared flycatcher, suggest that, as breeding density, a proxy of habitat quality, decreases, dispersing individuals invest less in reproduction but maintain a stable oxidative balance, whereas philopatric individuals maintain a high reproductive investment at the expense of increased oxidative stress. In this study, we aimed at experimentally testing whether these observed differences between dispersing and philopatric individuals across a habitat quality gradient were due to food availability, a major component of habitat quality in this system. We provided additional food for the parents to use during the nestling rearing period and we measured subsequent parental reproductive effort (through provisioning rate, adult body mass, and plasmatic markers of oxidative balance) and reproductive output. Density-dependent differences between dispersing and philopatric parents in body mass and fledging success were observed in control nests but not in supplemented nests. However, density-dependent differences in oxidative state were not altered by the supplementation. Altogether, our results support our hypothesis that food availability is responsible for some of the density-dependent differences observed in our population between dispersing and philopatric individuals but other mechanisms are also at play. Our study further emphasizes the need to account for environmental variation when studying the association between dispersal and other traits.

opencc-zeroDec 2016View details →
zenodo32/100

Open Datasets - available file for Design of Experimental (RSM) model, ANOVA table, SEM, VSM and Zeta potecial data for the nanocrystal clusters based on iron oxide.

<p>The open-access data from the statistical model for the design of experiment optimization and as well as the experimental data are available for the community. The data are&nbsp; based on an obtained results published in the article: https://www.mdpi.com/2079-4991/11/2/360</p>

opencc-by-4.0Jun 2021View details →
zenodo32/100

A CLOSE-UP LOOK AT THE CHEMICAL SPACE OF COMMERCIALLY AVAILABLE BUILDING BLOCKS FOR MEDICINAL CHEMISTRY

<p>The ability to efficiently synthesize desired compounds can be a limiting factor for chemical space exploration in drug discovery. This ability is conditioned not only by the existence of well-studied synthetic protocols but also by the availability of corresponding reagents, so-called building blocks (BB). In this work, we present a detailed analysis of the chemical space of 400K purchasable BB. The chemical space was defined by corresponding synthons &ndash; fragments contributed to the final molecules upon reaction. They allow an analysis of BB physicochemical properties and diversity, unbiased by the leaving and protective groups in actual reagents. The main classes of BB were analyzed in terms of their availability, rule-of-two-defined quality, and diversity. Available BBs were eventually compared to a reference set of biologically relevant synthons derived from ChEMBL fragmentation, in order to illustrate how well they cover the actual medicinal chemistry needs. This was performed on a newly constructed universal generative topographic map of synthon chemical space, allowing to visualize both libraries and analyze their overlapping and library-specific regions.</p> <p>The dataset includes annotated synthons extracted from ChEMBL and publicly available.</p>

opencc-by-4.0Jul 2021View details →
zenodo32/100

Figure 8. Adults captured per hour averaged for the four central weeks, 22 March–18 April, from 1994–2017. Data were not available for 1997, 1999–2001 in A long-term survey of spring monarch butterflies in north-central Florida

Figure 8. Adults captured per hour averaged for the four central weeks, 22 March–18 April, from 1994–2017. Data were not available for 1997, 1999–2001, and 2003–2004.

opennotspecifiedSep 2018View details →
dryad32/100

Burrow ambient temperature influences Helice crab activity and availability for migratory Red-crowned Cranes Grus japonensis

<p><span><span><span><span><span><span><span><span><span><span><span>For migratory birds that specialize on particular benthic macroinvertebrate species, the timing of migration is critical since prey availability may be temporally limited and a function of local ambient temperature. Hence, variation in local ambient temperature can influence the diet composition of migrant birds, and consequently they may be constrained by which stopover and wintering sites they are able to utilize during periods of colder temperatures. Here we use faecal analysis, observer-based population counts, digital video-recordings, and temperature data to test five predictions regarding the influence of local ambient temperature on the activity and availability of mudflat crabs - a key prey resource at three staging/wintering sites in eastern China, for migratory Red-crowned cranes (<i><span>Grus japonensis</span></i>) and how this subsequently influences crane diet and use of wetland sites. Pearson's correlations and generalised linear models revealed that mudflat crabs became significantly more surface active with increasing burrow ambient temperature. Piecewise regression analysis revealed that crab surface activity was largely limited to a burrow ambient temperature threshold between 12~13℃ after which activity significantly increased. Crab activity declining temporally during the crane's autumn migration period but increased during spring migration. Crabs accounted for a significant proportion of crane diet at two of three sites, however the frequency of crab remains was significantly different between sites, and between autumn and spring migration. Analyses of crane count data revealed a degree of congruence between the migration timing of Red-crowned cranes with periods of warmer ambient temperature, and a significant, positive correlation between the percentage of crab remains in crane faeces and site ambient temperature. Collectively our data suggests that temperature-related mudflat crab activity may provide an important time window for migratory Red-crowned cranes to utilise critical stop-over sites and the crabs' food resources.</span></span></span></span></span></span></span></span></span></span></span></p>

opencc-zeroAug 2021View details →
dryad32/100

Data from: Influence of habitat availability and fire disturbance on the northern range boundary of eastern white cedar (Thuja occidentalis L.)

Aim <p>Non-climatic constraints on species northern range boundaries are often overlooked in attempts to predict climate-induced range shifts. Here, we examined the effects of habitat availability and fire disturbance on the distribution of eastern white cedar (<i>Thuja occidentalis</i> L.) at the northern boundary of its range.</p> Location <p>North-western Quebec, Canada (46-51° N and 74-79° W)</p> Methods <p>We used forest inventory data (<i>n</i>=4,987) to characterize white-cedar habitat based on edaphic and topographic conditions at sampled sites along a 600-km latitudinal gradient. Non-metric multidimensional scaling was used to assess habitat similarity of sites in the south, where white-cedar stands are abundant, and sites in the north, where white-cedar stands are rare. We constructed ensemble white cedar distribution models based on habitat variables in the south and compared ensemble forecast projections of white cedar in the north with observed occurrences to determine if habitat availability was limiting. We independently estimated the age of white-cedar stands and adjacent stands without white cedar along the gradient. ANOVA was performed to test the age difference between white-cedar and adjacent stands to determine if the location of white-cedar stands was influenced by disturbance, primarily stand-replacing fire.</p> Results <p>Habitat availability was not limiting the distribution of eastern white cedar at its northern range boundary. White cedar did not occupy most sites with suitable habitat in the north, suggesting that other factors prevent white cedar from establishing more stands northward. White-cedar stands were older than adjacent stands without white cedar all along the gradient, but the difference was more pronounced in the north. This suggests that white-cedar stands in the north are restricted to undisturbed areas.</p> Main conclusions <p>Fire disturbance, more than habitat availability, limits the distribution of white cedar at its northern range boundary. Projections of white cedar distribution under climate change that ignore fire could overestimate the ability of warming temperatures to extend its northern range limit.</p>

opencc-zeroSep 2021View details →
zenodo32/100

maximal time of availability of aggregated records

<p>Establish maximal time of availability of the precise versions of records in an aggregating zip archive by publishing SHA256 sums of the archive.</p>

opencc-by-4.0Sep 2021View details →
dryad32/100

Performance tradeoffs and resource availability drive variation in reproductive isolation between sympatrically diverging crossbills

<p>Theoretical models indicate that speciation, especially when the scope for gene flow is great (e.g., sympatric speciation), is most likely when strong performance tradeoffs coincide with reproduction. We tested this classic hypothesis using measures of the strength of three prezygotic reproductive isolating barriers (habitat isolation, reduced immigrant fecundity, and behavioral isolation) between two young (~2,000 yrs) and sympatric red crossbill (<i>Loxia curvirostra</i>) ecotypes. All three isolating barriers increased with increases in performance tradeoffs, with total reproductive isolation varying between 0.72 and 1 (0 represents random mating, 1 represents complete reproductive isolation). Strong tradeoffs led to strong habitat isolation, an inability to breed in the "wrong" habitat, and more assortative flocks, with the latter leading to stronger behavioral isolation. Reproductive isolation decreased as resource availability increased relative to the demands of breeding, with higher resource availabilities eliminating the positive relationship between reproductive isolation and performance tradeoffs. This latter result is consistent with previous work suggesting that increasing resource abundance dampens the effect of strong performance tradeoffs on evolutionary divergence. Because many organisms, with the notable exception of host-specific phytophagous insects, rely on abundant food resources with weak performance tradeoffs while breeding, our results may explain why sympatric speciation is uncommon.</p>

opencc-zeroOct 2021View details →
zenodo32/100

Large diatom bloom off the Antarctic Peninsula during cool conditions associated with the 2015/2016 El Niño: data availability

<p>This dataset contains the results of&nbsp;phytoplankton chemotaxonomic groups derived from the HPLC/CHEMTAX analysis. The data were collected during the late spring and mid-late summer (November, January and February, respectively) of 2015/2016 along the Northern Antarctic Peninsula. This dataset includes an additional content in respect to&nbsp;diatom biomass proportion, collected between 2008-2017 during the late summer (February) along the Northern Antarctic Peninsula. The indices used in the study are also presented.&nbsp;&nbsp;</p>

opencc-by-4.0Oct 2021View details →
zenodo32/100

Data Availability for "Function of four tryptophan residues on Cel7A catalytic efficiency: insight into cellulase screening strategy based on natural cellulose or cellulose analogs"

<p><strong>The data support for this article &quot;Function of four tryptophan residues on Cel7A catalytic efficiency: insight into cellulase screening strategy based on natural cellulose or cellulose analogs&quot;</strong></p>

opencc-by-4.0Oct 2022View details →
dryad32/100

Apparent thermal acclimation of soil heterotrophic respiration mainly mediated by substrate availability

<p><span>Multiple lines of existing evidence suggest that increasing CO<sub>2</sub> emission from soils</span> <span>in response to rising temperatures could accelerate global warming. However, in experimental studies, the initial positive response of soil heterotrophic respiration (</span><span>R</span><sub><span>H</span></sub><span>) to</span><span> warming often weakens over time (referred to apparent thermal acclimation). If the</span><span> decreased </span><span>R</span><span>H</span> <span>is driven by</span><span> the thermal adaptation of soil microbial community, the potential for soil carbon (C) losses would be reduced substantially. In the meanwhile, the response could </span><span>equally be caused by substrate depletion, and would then </span><span>reflect the gradual loss of soil C.</span> <span>To address uncertainties regarding the causes of apparent thermal acclimation, we carried out </span><span>sterilization and inoculation</span><span> experiments using the soil samples from an alpine meadow with 6-years of warming and nitrogen (N) addition. We demonstrate</span><span> that substrate depletion, rather than microbial adaptation, determined the response of R<sub>H</sub> to long-term warming. Furthermore, </span><span>N addition appeared to alleviate the apparent acclimation of </span><span>R</span><sub><span>H</span></sub><span> to warming. Our study provides strong empirical support for </span><span>substrate availability being the cause of the </span><span>apparent acclimation of soil </span><span>microbial respiration to temperature. Thus, t</span><span>hese mechanistic insights</span><span> could</span><span> facilitate efforts of biogeochemical modeling to accurately project soil C stocks in the future climate.</span></p>

opencc-zeroNov 2022View details →
zenodo32/100

Data availability Leopard social organization

<p>Data supporting findings reported in&nbsp;&#39;Social organization of a solitary carnivore, the leopard (Panthera pardus), inferred from behavioural interactions at marking sites&#39;.</p>

opencc-by-4.0Nov 2022View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record