Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
3,818
datasets available to search
ShareScore release 0.9.0
Dataset results
3,818 results for “Differential Expression”
Table 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
<p><b>Table 1:</b> Details of target genes (<i>hif-1α</i>, <i>hsp70</i>, <i>ras</i>, <i>mstn</i>, <i>acly</i>, <i>per-1</i>, <i>cry-1</i>, <i>ube3a</i> and <i>ogt</i>) and reference genes (<i>β- tubulin</i> and <i>β- actin</i>) primers.</p><table><tbody><tr><th><b>Gene</b></th><th><b>Length (bp)</b></th><th><b>R</b> <b>2</b></th><th><b>Efficiency (%)</b></th><th><b>Primers sequence (5ʹ-3ʹ) forward/reverse</b></th></tr></tbody><tbody><tr><th><i>tubulin</i> -F</th><td>20</td><td>0.99</td><td>109.5</td><td>GACGTGGTGCCCAAAGATGT</td></tr><tr><th><i>tubulin</i> -R</th><td>18</td><td>TGGATGGTGCGCTTGGT</td></tr><tr><th><i>β- actin</i> -F</th><td>21</td><td>0.99</td><td>100.5</td><td>GCTGTTTTCCCCTCCATTGTT</td></tr><tr><th><i>β- actin</i> -R</th><td>19</td><td>TCCCATGCCAACCATCACT</td></tr><tr><th><i>hif-1α</i> -F</th><td>20</td><td>0.99</td><td>105.2</td><td>CTTCTGAGCTCTGATGAGGC</td></tr><tr><th><i>hif-1α</i> -R</th><td>20</td><td>GAAAGCACCATCAGGAAGCC</td></tr><tr><th><i>hsp-70</i> -F</th><td>20</td><td>0.99</td><td>100.9</td><td>GCAAGGAGAACAAGATCACC</td></tr><tr><th><i>hsp-70</i> -R</th><td>19</td><td>CACTCCGTTGCACTTGTCC</td></tr><tr><th><i>mstn</i> -F</th><td>20</td><td>0.98</td><td>100.5</td><td>AATCCAAGCGAGGGAAAAGC</td></tr><tr><th><i>mstn</i> -R</th><td>22</td><td>CCTCCATCACCTGAAAGGTCTT</td></tr><tr><th><i>ras</i> -F</th><td>20</td><td>0.97</td><td>99.31</td><td>CCAGTACATGAGGACAGGAG</td></tr><tr><th><i>ras</i> -R</th><td>20</td><td>CAAGCACCATTGGCACATCG</td></tr><tr><th><i>acly</i> -F</th><td>19</td><td>0.99</td><td>100.7</td><td>ATCATCTCCCGCACTACAG</td></tr><tr><th><i>acly</i> -R</th><td>19</td><td>TACCTCCAATCTCTCCCAG</td></tr><tr><th><i>ube3a</i> -F</th><td>21</td><td>0.98</td><td>103.3</td><td>GCCATAAGCAAGCAGCACAAC</td></tr><tr><th><i>ube3a</i> -R</th><td>19</td><td>CCAGTCAGTCCGCACATCG</td></tr><tr><th><i>per-1</i> -F</th><td>20</td><td>0.98</td><td>104.1</td><td>TGTTGAAGTTTGTGCCCCAG</td></tr><tr><th><i>per-1</i> -R</th><td>18</td><td>CAGTCCAGATGCTCCTCC</td></tr><tr><th><i>cry-1</i> -F</th><td>19</td><td>0.99</td><td>103.6</td><td>GTCCAACAGCCCTCAAACT</td></tr><tr><th><i>cry-1</i> -R</th><td>18</td><td>TACGCCAAGCACTCCAGA</td></tr><tr><th><i>ogt</i> -F</th><td>19</td><td>0.99</td><td>104.1</td><td>CCTCCCTTTGCTGTGTTCC</td></tr><tr><th><i>ogt</i> -R</th><td>20</td><td>TGTCTGCTTTCCGCTTTCGC</td></tr></tbody></table>
RNA-Seq analysis to identify differentially expressed genes in top and bottom leaves under Alternaria brassicicola infection
<p>The broccoli plants were infected with Alternaria brassicicola and RNA samples were extracted for control and inoculated plants at 10 days post inoculation. </p>
Single-cell RNA-seq count data used in differential expression benchmark study
<p>Count matrices and meta data tables from simulated and real world immune cell single-cell RNA-seq experiments.</p> <p>All files are in Rds format and can be read by R using "readRDS()". </p> <ul> <li>10k_*: These files contain a filtered version of the 10k Human PBMCs, 3' v3.1 data <a href="https://www.10xgenomics.com/resources/datasets/10k-human-pbmcs-3-v3-1-chromium-controller-3-1-high">published</a> by 10x Genomics</li> <li>blueprint_data.Rds: This file contains the bulk RNA-seq data downloaded from <a href="http://dcc.blueprint-epigenome.eu">BLUEPRINT</a></li> <li>blueprint_immune_comparisons.Rds: Results from running three bulk RNA-seq differential expression methods</li> <li>sim_data*: These files contain the count matrices and meta data tables for the simulated data. Every file contains a list of 13 replicates.</li> </ul> <p> </p>
Data from: Differential gene expression and mitonuclear incompatibilities in fast- and slow-developing inter-population Tigriopus californicus hybrids
<p>Mitochondrial functions are intimately reliant on proteins and RNAs encoded in both the nuclear and mitochondrial genomes, leading to inter-genomic coevolution within taxa. Hybridization can break apart coevolved mitonuclear genotypes, resulting in decreased mitochondrial performance and reduced fitness. This hybrid breakdown is an important component of outbreeding depression and early-stage reproductive isolation. However, the mechanisms contributing to mitonuclear interactions remain poorly resolved. Here we scored variation in developmental rate (a proxy for fitness) among reciprocal F2 inter-population hybrids of the intertidal copepod <em>Tigriopus californicus</em>, and used RNA sequencing to assess differences in gene expression between fast- and slow-developing hybrids. In total, differences in expression associated with developmental rate were detected for 2,925 genes, whereas only 135 genes were differentially expressed as a result of differences in mitochondrial genotype. Up-regulated expression in fast developers was enriched for genes involved in chitin-based cuticle development, oxidation-reduction processes, hydrogen peroxide catabolic processes, and mitochondrial respiratory chain complex I. In contrast, up-regulation in slow developers was enriched for DNA replication, cell division, DNA damage, and DNA repair. Eighty-four nuclear-encoded mitochondrial genes were differentially expressed between fast- and slow-developing copepods, including twelve subunits of the electron transport system (ETS) which all had higher expression in fast developers than in slow developers. Nine of these genes were subunits of ETS complex I. Our results emphasize the major roles that mitonuclear interactions within the ETS, particularly in complex I, play in hybrid breakdown, and resolve strong candidate genes for involvement in mitonuclear interactions.</p>
Breast Cancer Differential expressed genes from TCGA
<p>Breast cancer gene expression data from TCGA, Differential expression analysis result from DESeq2 R package comparing normal cells with breast cancer cells.</p>
curatedPCaData supplementary data table for differential gene expression analysis
<p>This tab-separated plaintext file contains differential gene expression analyses reported for the curatedPCaData data resource publication.</p>
Data from: Seasonally sympatric but allochronic: differential expression of hypothalamic genes in a songbird during gonadal development
Open the record for dataset details and reuse information.
Single cell multiomic analysis identifies key genes differentially expressed in innate lymphoid cells from COVID-19 patients
Open the record for dataset details and reuse information.
Data from: Role of serotonin in human placental cytotrophoblast differentiation and gene expression
Open the record for dataset details and reuse information.
Data from: Sperm competitive advantage of a rare mitochondrial haplogroup linked to differential expression of mitochondrial oxidative phosphorylation genes
Open the record for dataset details and reuse information.
Data from: Effects of a second iron dextran injection administered to piglets during lactation on differential gene expression in liver and duodenum at weaning
Open the record for dataset details and reuse information.
Data for: Adaptive tail-length evolution in deer mice is associated with differential Hoxd13 expression in early development
Open the record for dataset details and reuse information.
Parallel shifts in differential gene expression reveal convergent miniaturization in fishes
Open the record for dataset details and reuse information.
Data from: A novel approach to wildlife transcriptomics provides evidence of disease-mediated differential expression and changes to the microbiome of amphibian populations
Open the record for dataset details and reuse information.
Methylation and gene expression data from: Differential DNA methylation across environments has no effect on gene expression in the eastern oyster
Open the record for dataset details and reuse information.
Data from: Differential gene expression and mitonuclear incompatibilities in fast- and slow-developing inter-population Tigriopus californicus hybrids
Open the record for dataset details and reuse information.
Differential expression of olfactory genes in Atlantic salmon (Salmo salar) during the parr-smolt transformation
Open the record for dataset details and reuse information.
Data from: The leading edge matters too: fitness and the expression of adaptive differentiation are greatest at the high-elevation edge of a species range
Open the record for dataset details and reuse information.
Data from: Mild temperatures differentiate while extreme temperatures unify gene expression profiles among populations of Dicosmoecus gilvipes in California
Open the record for dataset details and reuse information.
In vivo differentially-expressed genes in Peromyscus leucopus, Mus musculus, and Rattus norvegicus blood in response to LPS
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.