Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

3,818

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

3,818 results for “Differential Expression”

Learn how ShareScore rates datasets ↗
zenodo36/100

Table 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions

<p><b>Table 1:</b> Details of target genes (<i>hif-1&alpha;</i>, <i>hsp70</i>, <i>ras</i>, <i>mstn</i>, <i>acly</i>, <i>per-1</i>, <i>cry-1</i>, <i>ube3a</i> and <i>ogt</i>) and reference genes (<i>&beta;- tubulin</i> and <i>&beta;- actin</i>) primers.</p><table><tbody><tr><th><b>Gene</b></th><th><b>Length (bp)</b></th><th><b>R</b> <b>2</b></th><th><b>Efficiency (%)</b></th><th><b>Primers sequence (5ʹ-3ʹ) forward/reverse</b></th></tr></tbody><tbody><tr><th><i>tubulin</i> -F</th><td>20</td><td>0.99</td><td>109.5</td><td>GACGTGGTGCCCAAAGATGT</td></tr><tr><th><i>tubulin</i> -R</th><td>18</td><td>TGGATGGTGCGCTTGGT</td></tr><tr><th><i>&beta;- actin</i> -F</th><td>21</td><td>0.99</td><td>100.5</td><td>GCTGTTTTCCCCTCCATTGTT</td></tr><tr><th><i>&beta;- actin</i> -R</th><td>19</td><td>TCCCATGCCAACCATCACT</td></tr><tr><th><i>hif-1&alpha;</i> -F</th><td>20</td><td>0.99</td><td>105.2</td><td>CTTCTGAGCTCTGATGAGGC</td></tr><tr><th><i>hif-1&alpha;</i> -R</th><td>20</td><td>GAAAGCACCATCAGGAAGCC</td></tr><tr><th><i>hsp-70</i> -F</th><td>20</td><td>0.99</td><td>100.9</td><td>GCAAGGAGAACAAGATCACC</td></tr><tr><th><i>hsp-70</i> -R</th><td>19</td><td>CACTCCGTTGCACTTGTCC</td></tr><tr><th><i>mstn</i> -F</th><td>20</td><td>0.98</td><td>100.5</td><td>AATCCAAGCGAGGGAAAAGC</td></tr><tr><th><i>mstn</i> -R</th><td>22</td><td>CCTCCATCACCTGAAAGGTCTT</td></tr><tr><th><i>ras</i> -F</th><td>20</td><td>0.97</td><td>99.31</td><td>CCAGTACATGAGGACAGGAG</td></tr><tr><th><i>ras</i> -R</th><td>20</td><td>CAAGCACCATTGGCACATCG</td></tr><tr><th><i>acly</i> -F</th><td>19</td><td>0.99</td><td>100.7</td><td>ATCATCTCCCGCACTACAG</td></tr><tr><th><i>acly</i> -R</th><td>19</td><td>TACCTCCAATCTCTCCCAG</td></tr><tr><th><i>ube3a</i> -F</th><td>21</td><td>0.98</td><td>103.3</td><td>GCCATAAGCAAGCAGCACAAC</td></tr><tr><th><i>ube3a</i> -R</th><td>19</td><td>CCAGTCAGTCCGCACATCG</td></tr><tr><th><i>per-1</i> -F</th><td>20</td><td>0.98</td><td>104.1</td><td>TGTTGAAGTTTGTGCCCCAG</td></tr><tr><th><i>per-1</i> -R</th><td>18</td><td>CAGTCCAGATGCTCCTCC</td></tr><tr><th><i>cry-1</i> -F</th><td>19</td><td>0.99</td><td>103.6</td><td>GTCCAACAGCCCTCAAACT</td></tr><tr><th><i>cry-1</i> -R</th><td>18</td><td>TACGCCAAGCACTCCAGA</td></tr><tr><th><i>ogt</i> -F</th><td>19</td><td>0.99</td><td>104.1</td><td>CCTCCCTTTGCTGTGTTCC</td></tr><tr><th><i>ogt</i> -R</th><td>20</td><td>TGTCTGCTTTCCGCTTTCGC</td></tr></tbody></table>

opencc-by-4.0Dec 2023View details →
zenodo36/100

RNA-Seq analysis to identify differentially expressed genes in top and bottom leaves under Alternaria brassicicola infection

<p>The broccoli plants were infected with Alternaria brassicicola and RNA samples were extracted for control and inoculated plants at 10 days post inoculation.&nbsp;</p>

opencc-by-4.0Nov 2024View details →
zenodo36/100

Single-cell RNA-seq count data used in differential expression benchmark study

<p>Count matrices and meta data tables from&nbsp;simulated and real world immune cell single-cell RNA-seq experiments.</p> <p>All files are in Rds format and can be read by&nbsp;R using &quot;readRDS()&quot;.&nbsp;</p> <ul> <li>10k_*: These files contain a filtered version of the 10k Human PBMCs, 3&#39; v3.1&nbsp;data <a href="https://www.10xgenomics.com/resources/datasets/10k-human-pbmcs-3-v3-1-chromium-controller-3-1-high">published</a> by 10x Genomics</li> <li>blueprint_data.Rds: This file contains the bulk RNA-seq&nbsp;data downloaded from <a href="http://dcc.blueprint-epigenome.eu">BLUEPRINT</a></li> <li>blueprint_immune_comparisons.Rds: Results from running three bulk RNA-seq differential expression methods</li> <li>sim_data*: These files contain the count matrices and meta data tables for the simulated data. Every file&nbsp;contains a list of 13 replicates.</li> </ul> <p>&nbsp;</p>

opencc-by-4.0Mar 2023View details →
dryad36/100

Data from: Differential gene expression and mitonuclear incompatibilities in fast- and slow-developing inter-population Tigriopus californicus hybrids

<p>Mitochondrial functions are intimately reliant on proteins and RNAs encoded in both the nuclear and mitochondrial genomes, leading to inter-genomic coevolution within taxa. Hybridization can break apart coevolved mitonuclear genotypes, resulting in decreased mitochondrial performance and reduced fitness. This hybrid breakdown is an important component of outbreeding depression and early-stage reproductive isolation. However, the mechanisms contributing to mitonuclear interactions remain poorly resolved. Here we scored variation in developmental rate (a proxy for fitness) among reciprocal F2 inter-population hybrids of the intertidal copepod <em>Tigriopus californicus</em>, and used RNA sequencing to assess differences in gene expression between fast- and slow-developing hybrids. In total, differences in expression associated with developmental rate were detected for 2,925 genes, whereas only 135 genes were differentially expressed as a result of differences in mitochondrial genotype. Up-regulated expression in fast developers was enriched for genes involved in chitin-based cuticle development, oxidation-reduction processes, hydrogen peroxide catabolic processes, and mitochondrial respiratory chain complex I. In contrast, up-regulation in slow developers was enriched for DNA replication, cell division, DNA damage, and DNA repair. Eighty-four nuclear-encoded mitochondrial genes were differentially expressed between fast- and slow-developing copepods, including twelve subunits of the electron transport system (ETS) which all had higher expression in fast developers than in slow developers. Nine of these genes were subunits of ETS complex I. Our results emphasize the major roles that mitonuclear interactions within the ETS, particularly in complex I, play in hybrid breakdown, and resolve strong candidate genes for involvement in mitonuclear interactions.</p>

opencc-zeroMar 2023View details →
zenodo36/100

Breast Cancer Differential expressed genes from TCGA

<p>Breast cancer gene expression data from TCGA, Differential expression analysis result from DESeq2 R package comparing normal cells with breast cancer cells.</p>

opencc-by-4.0May 2023View details →
zenodo36/100

curatedPCaData supplementary data table for differential gene expression analysis

<p>This tab-separated plaintext file&nbsp;contains differential gene expression analyses reported for the curatedPCaData data resource publication.</p>

opencc-by-4.0May 2023View details →
dryad36/100

Data from: Seasonally sympatric but allochronic: differential expression of hypothalamic genes in a songbird during gonadal development

Open the record for dataset details and reuse information.

publicOct 2018View details →
dryad36/100

Single cell multiomic analysis identifies key genes differentially expressed in innate lymphoid cells from COVID-19 patients

Open the record for dataset details and reuse information.

publicJul 2024View details →
dryad36/100

Data from: Role of serotonin in human placental cytotrophoblast differentiation and gene expression

Open the record for dataset details and reuse information.

publicJul 2025View details →
dryad36/100

Data from: Sperm competitive advantage of a rare mitochondrial haplogroup linked to differential expression of mitochondrial oxidative phosphorylation genes

Open the record for dataset details and reuse information.

publicSep 2019View details →
dryad36/100

Data from: Effects of a second iron dextran injection administered to piglets during lactation on differential gene expression in liver and duodenum at weaning

Open the record for dataset details and reuse information.

publicDec 2023View details →
dryad36/100

Data for: Adaptive tail-length evolution in deer mice is associated with differential Hoxd13 expression in early development

Open the record for dataset details and reuse information.

publicFeb 2024View details →
dryad36/100

Parallel shifts in differential gene expression reveal convergent miniaturization in fishes

Open the record for dataset details and reuse information.

publicOct 2025View details →
dryad36/100

Data from: A novel approach to wildlife transcriptomics provides evidence of disease-mediated differential expression and changes to the microbiome of amphibian populations

Open the record for dataset details and reuse information.

publicFeb 2018View details →
dryad36/100

Methylation and gene expression data from: Differential DNA methylation across environments has no effect on gene expression in the eastern oyster

Open the record for dataset details and reuse information.

publicDec 2021View details →
dryad36/100

Data from: Differential gene expression and mitonuclear incompatibilities in fast- and slow-developing inter-population Tigriopus californicus hybrids

Open the record for dataset details and reuse information.

publicMar 2023View details →
dryad36/100

Differential expression of olfactory genes in Atlantic salmon (Salmo salar) during the parr-smolt transformation

Open the record for dataset details and reuse information.

publicNov 2019View details →
dryad36/100

Data from: The leading edge matters too: fitness and the expression of adaptive differentiation are greatest at the high-elevation edge of a species range

Open the record for dataset details and reuse information.

publicDec 2025View details →
dryad36/100

Data from: Mild temperatures differentiate while extreme temperatures unify gene expression profiles among populations of Dicosmoecus gilvipes in California

Open the record for dataset details and reuse information.

publicSep 2022View details →
dryad36/100

In vivo differentially-expressed genes in Peromyscus leucopus, Mus musculus, and Rattus norvegicus blood in response to LPS

Open the record for dataset details and reuse information.

publicJun 2023View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record