Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
183
datasets available to search
ShareScore release 0.9.0
Dataset results
183 results for “Eulipotyphla”
Fig. 7 in Geographic variation and biogeography of the greater Japanese shrew mole Urotrichus talpoides (Eulipotyphla: Talpidae)
Fig. 7. Box plots of (A) I2I2, (B) RB, (D) BD, and two-dimensional plots of RB and BB given as the ratio of GLS, with different colors and symbols for each of the 8 localities: East Honshu (black, filled dot); West Honshu (black, open dot); Shikoku (black, filled diamond); Northern Kyushu (black, open triangle); Southern Kyushu (black, filled triangle); Oki Islands (gray, open square); Mishima Island (gray, plus symbol); Tsushima Island (gray, X symbol).
Fig. 4 in Geographic variation and biogeography of the greater Japanese shrew mole Urotrichus talpoides (Eulipotyphla: Talpidae)
Fig. 4. Box plots of the greatest length of skull (GLS) of Urotrichus talpoides from 8 geographic localities, in mm.
Fig. 5 in Geographic variation and biogeography of the greater Japanese shrew mole Urotrichus talpoides (Eulipotyphla: Talpidae)
Fig. 5. Scatter plots of the scores of (A) the first and second and (B) the second and third axes of discriminant analysis based on grouping in the 8 geographic localities with different colors and symbols: East Honshu (black, filled dot); West Honshu (black, open dot); Shikoku (black, filled diamond); Northern Kyushu (black, open triangle); Eastern and Southern Kyushu (black, filled triangle); Oki Islands (gray, open square); Mishima Island (gray, plus symbol); Tsushima Island (gray, X symbol).
Fig. 6 in Geographic variation and biogeography of the greater Japanese shrew mole Urotrichus talpoides (Eulipotyphla: Talpidae)
Fig. 6. Box plots of (A) P4M3, (B) P M, and (C) LTR of Urotrichus talpoides from 8 geographic localities, in mm.
Fig. 3 in Geographic variation and biogeography of the greater Japanese shrew mole Urotrichus talpoides (Eulipotyphla: Talpidae)
Fig. 3. Scatter plots of the scores on the first and second axes of the principal component with different colors and symbols for each of the 8 localities: East Honshu (black, filled dot); West Honshu (black, open dot); Shikoku (black, filled diamond); Northern Kyushu (black, open triangle); Southern Kyushu (black, filled triangle); Oki Islands (gray, open square); Mishima Island (gray, plus symbol); Tsushima Island (gray, X symbol).
Fig. 1 in Geographic variation and biogeography of the greater Japanese shrew mole Urotrichus talpoides (Eulipotyphla: Talpidae)
Fig. 1. Sample localities for specimens of Urotrichus talpoides analyzed in this study. Details of locality names are provided in Table 1. The dotted line is the Kurobe–Fuji line of the karyotype boundary.
Table 1 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species
<p><b>Table 1.</b> Primers used for PCR and sequencing</p><table><tbody><tr><th>Locus</th><th>Primer name</th><th>Primer sequences</th><th>Sense/anti-sense</th><th>Reference</th></tr></tbody><tbody><tr><th><i>CYT B</i></th><td>L14724_hk3</td><td>GGACTTATGACATGAAAAATCATCGTTG</td><td>Sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><td>H15915_hk3</td><td>GATTCCCCATTTCTGGTTTACAAGAC</td><td>Anti-sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><th>12S</th><td>L613_hk1</td><td>GGCGGGCGAGCAAAGCACTGAAAATG</td><td>Sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><td>H1478_hk1</td><td>TGATTGGTGGAGGGTGACGAGCGGTGTGT</td><td>Anti-sense</td><td>He <i>et al.</i>, 2010</td></tr><tr><th><i>BRCA1</i></th><td>B1f</td><td>TGAGAACAGCACTTTATTACTCAC</td><td>Sense</td><td>Dubey <i>et al.</i>, 2006</td></tr><tr><td>B1r</td><td>ATTCTAGTTCCATATTGCTTATACTG</td><td>Anti-sense</td><td>Dubey <i>et al.</i>, 2006</td></tr><tr><th><i>APOB</i></th><td>ApoBf</td><td>GCAATCATTTGACTTAAGTG</td><td>Sense</td><td>Dubey <i>et al.</i>, 2007</td></tr><tr><td>ApoBr</td><td>GAGCAACAATATCTGATTGG</td><td>Anti-sense</td><td>Dubey <i>et al.</i>, 2007</td></tr><tr><th><i>RAG2</i></th><td>RAG2-F220</td><td>GATTCCTGCTAYCTYCCTCCTCT</td><td>Sense</td><td>Teeling <i>et al.</i>, 2000</td></tr><tr><td>RAG2-R995</td><td>CCCATGTTGCTTCCAAACCATA</td><td>Anti-sense</td><td>Teeling <i>et al.</i>, 2000</td></tr></tbody></table>
Figure 2 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species
Figure 2. Dorsal, ventral and lateral views of the skull and lateral views of the mandible of the holotype of Alpiscaptulus medogensis (KIZ: 037966; left) and Scapanulus oweni (KIZ: 033872; right). Scale bar = 10 mm.
Figure 5 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species
Figure 5. Results of maximum likelihood phylogenetic analyses of concatenated (A) mitochondrial genes, (B) nuclear genes and (C) mitochondrial-nuclear trees. Node numbers indicate Bayesian posterior probabilities (PP) and ultrafast bootstrap supports (UFBoot). Branch lengths represent substitutions per site.
Figure 1 in Evolutionary history of Sundaland shrews (Eulipotyphla: Soricidae: Crocidura) with a focus on Borneo
Figure 1. Map of tropical east Asia indicating biogeographic regions and sample localities in this study.
Figure 6 in Evolutionary history of Sundaland shrews (Eulipotyphla: Soricidae: Crocidura) with a focus on Borneo
Figure 6. Morphometric variation in the Crocidura foetida–C. baluensis-C. nigripes complex. A, shows first and second principal components from an analysis of 14 cranial dimensions; B, shows second and third principal components of that same analysis. PC1 shows differences in size of the different populations while PCs 2 and 3 highlight differences in shape.
Figure 5 in Evolutionary history of Sundaland shrews (Eulipotyphla: Soricidae: Crocidura) with a focus on Borneo
Figure 5. Whole Cytb haplotype median joining networks of two major lineages present in Borneo: Crocidura neglecta complex (A) and C. foetida, C. baluensis, C. nigripes, Philippine Crocidura (B). Branch lengths are proportional to the number of mutations, and this number has been specified on two branches as a scale.
Figure 4 in Evolutionary history of Sundaland shrews (Eulipotyphla: Soricidae: Crocidura) with a focus on Borneo
Figure 4. Species tree of Sundaland and Sulawesi Crocidura as estimated from 13 nuclear loci using *BEAST. Dates are indicated on nodes and bar along the bottom of phylogeny. Nodes used to calibrate the dating are marked with a black square. Highly supported nodes (PP> 0.95) are marked with a red circle, less supported nodes (0.95 0.80) are marked with a green circle, nodes with poor support (PP <0.80) are not marked. Samples are coloured based on its geographical origin and matching the map. Samples from north of the Isthmus of Kra are in grey.
Figure 3. Bayesian maximum clade credibility tree constructed from whole mitochondrial genome sequences, with a in Evolutionary history of Sundaland shrews (Eulipotyphla: Soricidae: Crocidura) with a focus on Borneo
Figure 3. Bayesian maximum clade credibility tree constructed from whole mitochondrial genome sequences, with a focus on Bornean Crocidura. Reconstructed with BEAST2. Dates are indicated on nodes and bar on bottom. Nodes used to calibrate the dating are marked with a black square. Uropsilus and Soricinae outgroups were included in the phylogenetic analysis for calibration purposes but removed from the figure for clarity. Since most nodes are highly supported (PP> 0.95), only less supported nodes (0.95 0.80) are marked with an orange circle. Colours on the vertical bar indicate geographical origin of sampled animals, and colors match the map. Samples from north of Kra are shown in grey.
Figure 3 in Microhabitat, diet, and reproductive activity of a population of the Andean shrew Cryptotis tamensis (Eulipotyphla: Soricidae)
Figure 3. Histological sections of the ovaries in Cryptotis tamensis. (a) A large active corpus luteum in the ovary of a female in early gestation; (b) a pre-antral follicle in the ovary of a non-pregnant female; (c) primordial, primary and secondary follicles in development in a non-reproductive female; (d) primordial follicles in the small ovaries of a juvenile female. Corpus luteum: circle with dashed line; pre-antral follicle: continuous-line circle; primary follicle: black arrows; secondary follicle: white arrows. Scale bars represent 200 μm.
Figure 2 in Microhabitat, diet, and reproductive activity of a population of the Andean shrew Cryptotis tamensis (Eulipotyphla: Soricidae)
Figure 2. Histological sections of testes (a,b) and epididymis (c,d) of Cryptotis tamensis. Images (a) and (c) show a reproductive male with abundant sperm in the luminal edge of the seminiferous tubules and in the lumen of its epididymis, and (b) and (c) show a non-reproductive male with only basal cells in the spermatic epithelium and empty, almost obliterated epididymis. Spermatozoids: circle, solid line; Sertoli cell: white arrowheads; spermatogonia: black arrowheads; primary spermatocytes: circle, dashed line. Scale bars represent 150 μm.
Figure 1 in Microhabitat, diet, and reproductive activity of a population of the Andean shrew Cryptotis tamensis (Eulipotyphla: Soricidae)
Figure 1. Monthly occurrence and body mass of the captured individuals of Cryptotis tamensis by sex and reproductive stage, related to the precipitation regime of the study area (dashed line; data on the rainfall pattern of the area were obtained from WorldClim; Fick and Hijmans 2017). Reproductive males, solid black rhombuses; non-reproductive males, white rhombuses; juvenile female, yellow square; non-reproductive females, white circles; preovulatory female, purple circle; early pregnant females, red circles; late pregnant female, white square.
FIGURE 9 in A new species of small-eared shrew of the genus Cryptotis (Mammalia, Eulipotyphla, Soricidae) from the northernmost Peruvian Andes
FIGURE 9. Paratype of Cryptotis evaristoi (MUSA 7412). Photograph by C.E. Medina on September 26, 2009.
FIGURE 8 in A new species of small-eared shrew of the genus Cryptotis (Mammalia, Eulipotyphla, Soricidae) from the northernmost Peruvian Andes
FIGURE 8. Dorsal and ventral views of the cranium and lateral view of the cranium and mandible of Cryptotis evaristoi (MUSA 7419, paratype). Scale bar = 5 mm.
FIGURE 7. Cytochrome oxidase subunit I in A new species of small-eared shrew of the genus Cryptotis (Mammalia, Eulipotyphla, Soricidae) from the northernmost Peruvian Andes
FIGURE 7. Cytochrome oxidase subunit I phylogenetic trees for Cryptotis genus. Bootstrap supports are indicated at each node for A. Maximum Likelihood; B. Posterior Probability values for Bayesian Inference.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.