Find research datasets worth reusing

Fig. 1 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1

Fig. 1. Localities of Liphistius species of the malayanus- group, tioman-group, linang-group and batuenis-group in peninsular Malaysia and southern Thailand (coast of Sumatra omitted): 1 - Gunung Angsi (type locality of L. malayanus); 2 - Templer Park and Gua Anak Takun (L. malayanus, L. batuensis); 3 - Genting Highlands (L. malayanus); 4 - Fraser's Hill (L. malayanus); 5 - Cameron Highlands (type locality of L. malayanus cameroni); 6 - Sungai Jasin in Endau Rompin National Park (type locality of L. endau); 7 - Gunung Belumut (L. endau); 8 - Gunung Muntahak (L. endau; type locality of L. gracilis sp. nov.); 9 - Sungai Rengit (type locality of L. johore); 10 - Gunung Kajang on Tioman Island (type locality of L. tioman); 11 - Gua Charas in Bukit Charas (type locality of L. panching); 12 - Nusa Camp in Taman Negara (type locality of L. negara sp. nov.); 13 - Jeram Linang Waterfall (type locality of L. linang sp. nov.); 14 - Sankalakhierie Mountains (type locality of L. indra); 15 - Batu Caves (type locality of L. batuensis); 16 - Gua Tempurung (type locality of L. tempurung); 17 - Gua Cicak (L. tempurung); 18 - Gua Keris (type locality of L. priceae sp. nov). Localities with conspecific populations are encircled. Colours distinguish species groups.

Fig. 14 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1

Fig. 14. Liphistius negara sp. nov., details of left palp of male holotype (A-C, E-H) and of male paratype (D); vulval plate of female allotype (I-J). (A) Distal part of palp, ventral view. (B) Distal part of tibia and base of tarsus, retroventral view. (C-D) Palpal organ, distal view (dorsal side up). (E) Same, proventral view. (F) Same, retrodorsal view. (G) Tibial apophysis, retrolateral and slightly proximal view. (H) Distal part of cymbium, prolateral view. (I) Vulval plate, dorsal view. (J) Same, ventral view. Abbreviation: t - tooth on distal edge of contrategulum. Scale lines: 1.0 mm (A; B, G-H; C-D; E-F; I-J).

Fig. 10 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1

Fig. 10. Liphistius johore, female holotype (A); Liphistius panching, male from type locality (B). (A) Dorsal view of vulval plate (redrawn from Platnick & Sedgwick, 1984: fig. 79) (arrows indicating anterolateral invaginations in margin of poreplate). (B) Distal view of left palpal organ (dorsal side up) (redrawn from Sedgwick & Platnick, 1986: fig. 5).

Fig. 12 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1

Fig. 12. Liphistius tioman, vulval plate of three females from the type locality: specimen moulted 17.XII.2001 (A-B); exuvia, moult 7.VI.2003 (C-E); exuvia, moult 16.II.2002 (F-G). (A, C, F) Entire structure, dorsal view. (B, D, G) Same, ventral view (vesicles in G omitted). (E) Receptacular cluster, ventral and slightly posterior view. Scale lines: 1.0 mm (A-B; C-G).

Fig. 20 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1

Fig. 20. Liphistius batuensis, vulval plate of five females from the type locality: exuvia, moult 24.I.2002 (A-B); specimen SMF 13907 (C); exuvia, moult 12.VII.2001 (D-E); specimen leg. XI.1976 (F); exuvia, moult 13.I.2002 (G-H). (A, C-D, F-G) Dorsal view. (B, E, H) Ventral view. Scale lines: 1.0 mm (A-B, D-E, G-H; C, F).

Fig. 2 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1

Fig. 2. Habitus of two Liphistius species from peninsular Malaysia and southern Thailand. (A) Liphistius endau, female from Kota Tinggi (Malaysia), dorsal view. (B) Liphistius indra sp. nov., male paratype from the Sankalakhierie Mountains (Thailand), same view.

Fig. 9 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1

Fig. 9. Liphistius gracilis sp. nov., vulval plate of three females (all from exuviae): allotype (A-B); paratype, moult 31.VIII.2001 (C- D); paratype, moult 27.IX.2001 (E-G). (A, C, E) Vulval plate, dorsal view. (B, D, F) Same, ventral view. (G) Same, anterior view. Scale lines: 1.0 mm (A-B; C-G).

Fig. 16 in A revision of the trapdoor spider genus Liphistius (Mesothelae: Liphistiidae) in peninsular Malaysia; part 1

Fig. 16. Liphistius linang sp. nov., vulval plate of three female paratypes (A-E): specimen moulted 30.VII.1999 (A-B), moulted 10.III.2000 (C), exuvia, moult 14.IX.1999 (D-E); undissected genital sternite of allotype (F). (A, C-D) Dorsal view. (B, E, F) Ventral view. Scale lines: 1.0 mm (A-E; F).

FIGURE 6 in Three new species of the primitively segmented spiders from Mt Yuelu, Hunan, China (Mesothelae, Liphistiidae)

FIGURE 6. Male and female genital anatomy of Songthela shuyuan sp. nov. A–C, male palp, holotype, DQ–2018–020; A, prolateral view; B, ventral view; C, retrolateral view; D–G, male palp, paratype, DQ–2018–049; D, prolateral view; E, ventral view; F, retrolateral view; G, distal view; H–K, female genitalia, dorsal view; L–O, female genitalia, ventral view; H–O, paratypes; H, L, DQ–2018–013; I, M, DQ–2018–019; J, N, DQ–2018–018; K, O, DQ–2018–035. Scale bars: A–O, 0.3 mm.

FIGURE 5 in Three new species of the primitively segmented spiders from Mt Yuelu, Hunan, China (Mesothelae, Liphistiidae)

FIGURE 5. Male and female genital anatomy of Songthela pyriformis sp. nov. A–C, male palp, holotype, XUX–2011–033; A, prolateral view; B, ventral view; C, retrolateral view; D–G, male palp, paratype, XUX–2011–020; D, prolateral view; E, ventral view; F, retrolateral view; G, distal view; H–J, female genitalia, dorsal view; K–M, female genitalia, ventral view; H–M, paratypes; H, K, XUX–2011–028; I, L, XUX–2011–024; J, M, XUX–2011–032. Scale bars: A–M, 0.3 mm.

FIGURE 3 in Three new species of the primitively segmented spiders from Mt Yuelu, Hunan, China (Mesothelae, Liphistiidae)

FIGURE 3. Microhabitat and general somatic morphology of Vinathela nenglianggu sp. nov. (DQ–2018–002, female; DQ– 2018–008, male); A, C, dorsal view; B, D, ventral view; E, microhabitat; F–G, the trapdoor with the door closed and open. Scale bars: A–D, 2 mm.

FIGURE 4 in Three new species of the primitively segmented spiders from Mt Yuelu, Hunan, China (Mesothelae, Liphistiidae)

FIGURE 4. Map showing the collection sites of three new species in Mt Yuelu, Changsha, Hunan, China.

FIGURE 2 in Three new species of the primitively segmented spiders from Mt Yuelu, Hunan, China (Mesothelae, Liphistiidae)

FIGURE 2. Microhabitat and general somatic morphology of Songthela shuyuan sp. nov. (DQ–2018–003, female; DQ–2018– 021, male); A, C, dorsal view; B, D, ventral view; E, microhabitat; F–G, the trapdoor with the door closed and open. Scale bars: A–D, 2 mm.

Figure 4 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Figure 4. The historical biogeography of Liphistius. A, chronogram and ancestral area reconstructions for Liphistius. The numbers in front of the names of taxa correspond to those in Table 1. B, distribution routes of the trang species group (red arrows) and the bristowei species group (blue arrows). Areas are as follows: A = Mainland Sibumasu; B = Peninsular Sibumasu; C = Inthanon region; D = Central basin; E = Bentong–Reaub suture zone; F = Sukhothai terrain; G = Chantaburi region; H = Indochina terrain (based on Metcalfe 2017); I = East Asia [the distributions of all heptatheline taxa combined into a single area (not shown)].

Figure 3 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Figure 3. Results of eight species delimitation methods. Each vertical bar represents a different delimitation method, and each horizontal bar represents a putative delimited species. Taxa 1–5 are each represented by only a single specimen. The colours in the phylogenetic tree represent Liphistius species groups, as follows: red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in Sibumasu; blue, trang group from localities in Indochina.

Figure 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Figure 2. Multi-locus phylogeny using Bayesian inference (BI) with 'GBLOCK partition' alignments. Dashed lines show incongruent clades between Bayesian inference and maximum likelihood (ML). Coloured branches on the tree correspond to Liphistius species groups as follows: red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in Sibumasu; blue, trang group from localities in Indochina.

Figure 1 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Figure 1. Distribution map of Liphistius. A, sample collection localities. Numbered collection locations correspond to those in Table 1. B, geological terrain: Sibumasu in the west (purple) and Indochina in the east (blue).

Table 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Table 2. Primers used and their annealing temperatures.<table><tbody><tr><th>Gene</th><th>Primer</th><th>Sequence (5 ʹ –3 ʹ)</th><th>Annealing temperature (°C)</th><th>Reference</th></tr></tbody><tbody><tr><th>CO1</th><td>LCO1490</td><td>GGTCAACAAATCATAAAGATATTGG</td><td>40</td><td>Folmer et al. (1994)</td></tr><tr><th></th><td>HCO2198</td><td>TAAACTTCAGGGTGACCAAAAAATCA</td><td>40</td><td>Folmer et al. (1994)</td></tr><tr><th>16S</th><td>16Sar</td><td>ATAGAGCTCCCATGGCGCCTGTTTAT CAAAAACAT</td><td>54</td><td>Huber et al. (1993)</td></tr><tr><th></th><td>16Sbr</td><td>ATAGAGCTCCCATGGCCGGTCTGAA CTCAGATCACGT</td><td>54</td><td>Huber et al. (1993)</td></tr><tr><th>ITS2</th><td>ITS-5.8S</td><td>GGGACGATGAAGAACGCAGC</td><td>47</td><td>White et al. (1990)</td></tr><tr><th></th><td>ITS-28S</td><td>TCCTCCGCTTATTGATATGC</td><td>47</td><td>White et al. (1990)</td></tr><tr><th>28S</th><td>28S-O</td><td>GAAACTGCTCAAAGGTAAACGG</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th></th><td>28S-C</td><td>GGTTCGATTAGTCTTTCGCC</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th>H3</th><td>H3aF</td><td>ATGGCTCGTACCAAGCAGACVGC</td><td>50</td><td>Colgan et al. (1998)</td></tr><tr><th></th><td>H3aR</td><td>ATATCCTTRGGCATRATRGTGAC</td><td>50</td><td>Colgan et al. (1998)</td></tr></tbody></table>

opennotspecifiedSep 2015View details →

Figure 5 in Integrative taxonomy of the primitively segmented spider genus Ganthela (Araneae: Mesothelae: Liphistiidae): DNA barcoding gap agrees with morphology

Figure 5. Ganthela jianensis Xu, Kuntner & Chen sp. nov. A, female (XUX-2013-536). B, C, female genitalia (XUX-2013-534): B, dorsal view; C, ventral view; RC, receptacular cluster. Scale bar 0.5 mm.