Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
152
datasets available to search
ShareScore release 0.9.0
Dataset results
152 results for “Serrasalmidae”
FIGURE 2 in Morphological and histometric features of the caudal kidney in piranha Pygocentrus nattereri (Characiformes: Serrasalmidae)
FIGURE 2 | Histological cross-sections of the caudal kidney in Pygocentrus nattereri highlighting the vascular features. A. Low magnification showing the typical aspect of the kidney parenchyma; segments of blood vessels (BV) are diffusely recognized in all regions; some granulomatous formations are often found (circles in black). HE, scale bar = 200 µm. B. Capillary network from larger vessels spread throughout the parenchyma (arrows) supplying the lymphohematopoietic areas (L); note an immature renal corpuscle (RC) near a capillary branch. HE, scale bar = 50 µm. C. Some RC are usually viewed very closed to larger vessels (V), proximal (PT) and distal tubules (DT); note the brush edge (arrowhead), a characteristic of PT. PAS, scale bar = 50 µm. D. A branch of the renal vein (V) near an RC; a thin collagen bundle can be seen surrounding the vessel. TM, scale bar = 50 µm. E. and F. Represents arterial irrigation of the RC, which demonstrate a thick collagenous layer (asterisk); in E., a large arteria (A) with a branch toward the glomerular area (arrow); in F., an arteriole (A) alongside an RC showing a slightly collagenous marking and Bowman's space (arrow); TM, E., scale bar = 50 µm; D., scale bar = 10 µm.
FIGURE 4 in Morphological and histometric features of the caudal kidney in piranha Pygocentrus nattereri (Characiformes: Serrasalmidae)
FIGURE 4 | Intracellular and intraluminal deposits in the caudal kidney of Pygocentrus natteri. A. Cross-section of proximal tubules showing intracytoplasmic single or multi droplets hyaline deposits in epithelial cells (arrows); HE, scale bar = 10 µm. B. Collecting duct presenting a luminal melanogenic macrophage; leukocyte cells often infiltrate the muscularis layer peripherally to the epithelial cells or enter the luminal space (arrows); HE, scale bar = 50 µm. C. Collecting tubule with an abundant luminal accumulation of melanogenic macrophages; HE, scale bar = 50 µm. D. Melanogenic macrophages and epithelial cells of a collecting duct; the cell's basophilic luminal border indicates a degenerative process (arrow); HE, scale bar = 10 µm. E. Area of focal necrosis involving the collecting duct epithelium with melanogenic macrophage infiltrate (arrowhead); hyaline deposits in the cytoplasm of tubular epithelial cells (asterisk) are observed; HE, scale bar = 50 µm.
FIGURE 6 in Morphological and histometric features of the caudal kidney in piranha Pygocentrus nattereri (Characiformes: Serrasalmidae)
FIGURE 6 | Frequency of hemosiderin and lipofuscin in the caudal kidney melanomacrophages centers (MMC) of Pygocentrus natteri. A. Frequency of area of pigments in tissue of female and male (mean, bars = epm). Differences between substances was observed (*), P = 0.006. B. Histological section stained with Perl's method for ferric iron for hemosiderin detection (arrow). C. Histological sections stained with Schmorl's solution for lipofuscin detection (arrow); scale bars = 50 µm.
FIGURE 7 in Genetic comparison of populations of Piaractus brachypomus and P. orinoquensis (Characiformes: Serrasalmidae) of the Amazon and Orinoco basins
FIGURE 7 | Discriminant analysis of principal components (DAPC) based in six microsatellite loci of 95 individuals of Piraractus orinoquensis.
FIGURE 6 in Genetic comparison of populations of Piaractus brachypomus and P. orinoquensis (Characiformes: Serrasalmidae) of the Amazon and Orinoco basins
FIGURE 6 | Management units of Piaractus. In Piaractus brachypomus the color blue corresponds to the MUs of the sedimentary basin (1), the color violet represents the south shield MUs (2) and the sky-blue color represents the northern shield MUs (3). Piaractus orinoquensis is represented by a single MU indicated in orange (4).
FIGURE 3 in Genetic comparison of populations of Piaractus brachypomus and P. orinoquensis (Characiformes: Serrasalmidae) of the Amazon and Orinoco basins
FIGURE 3 | Haplotype genealogies of Piaractus orinoquensis. The circle size is proportional to the haplotype frequency. Each line represents a single mutation. Colors correspond to localities.
FIGURE 2 in Genetic comparison of populations of Piaractus brachypomus and P. orinoquensis (Characiformes: Serrasalmidae) of the Amazon and Orinoco basins
FIGURE 2 | Haplotype genealogies of Piaractus brachypomus. The circle size is proportional to the haplotype frequency. Each line represents a single mutation. Colors correspond to localities.
FIGURE 1 in Genetic comparison of populations of Piaractus brachypomus and P. orinoquensis (Characiformes: Serrasalmidae) of the Amazon and Orinoco basins
FIGURE 1 | Map of the study area for sampling sites for Piaractus brachypomus and P. orinoquensis samples. The number inside the circle indicates the sampling location. The green circle indicates the samples that were analyzed for nDNA and the blue circle the samples analyzed with nDNA and mDNA. Orinoco basin (1. San José del Guaviare, 2. Puerto López, 3. Puerto Carreño, 4. San Fernando de Apure, 5. San Felix). Amazon basin (1. Guajará-Mirim, 2. Boca do Acre, 3. Leticia, 4. La Pedrera, 5. Cidade Japurá, 6. Parimé River, 7. Humaitá, 8. Cidade Juruá, 9. Tefé, 10. Beruri, 11. Janauacá, 12. Borba, 13. Itaituba. 14. Óbidos, 15. Santarém).
FIGURE 5 in Genetic comparison of populations of Piaractus brachypomus and P. orinoquensis (Characiformes: Serrasalmidae) of the Amazon and Orinoco basins
FIGURE 5 | Discriminant analysis of principal components (DAPC) based in seven microsatellite loci of 300 individuals of Piaractus brachypomus.
FIGURE 4 in Genetic comparison of populations of Piaractus brachypomus and P. orinoquensis (Characiformes: Serrasalmidae) of the Amazon and Orinoco basins
FIGURE 4 | A. Barplots created from Structure representing assignments of genotypes to each local population for Piaractus brachypomus, the blue color cluster represents individuals related to the Amazon sedimentary basin and the purple color cluster represents individuals related to the crystalline shields of the Amazon basin. B. Barplots hierarchical from crystalline shields of the Amazon basin.
Linked collectors and determiners for: A new species of Myloplus Gill (Characiformes, Serrasalmidae) from the Tumucumaque Mountain Range, Brazil and French Guiana, with comments on M. rubripinnis.
Natural history specimen data linked to collectors and determiners held within, "A new species of Myloplus Gill (Characiformes, Serrasalmidae) from the Tumucumaque Mountain Range, Brazil and French Guiana, with comments on M. rubripinnis". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/8b28e118-be14-4eb1-8997-033c50d8d5dd">https://bionomia.net/dataset/8b28e118-be14-4eb1-8997-033c50d8d5dd</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/8b28e118-be14-4eb1-8997-033c50d8d5dd">https://gbif.org/dataset/8b28e118-be14-4eb1-8997-033c50d8d5dd</a>. Formatted as a Frictionless Data package.
Figure 4 in Red-bellied Piranha Pygocentrus nattereri Kner, 1858 (Characiformes: Serrasalmidae) in open waters in R. Macedonia
Figure 4. Some of the osteological characters of P. nattereri from Dojran Lake.
Figure 1 in Red-bellied Piranha Pygocentrus nattereri Kner, 1858 (Characiformes: Serrasalmidae) in open waters in R. Macedonia
Figure 1. Location map showing the first record of P. nattereri in R. Macedonia.
Figure 6 in Red-bellied Piranha Pygocentrus nattereri Kner, 1858 (Characiformes: Serrasalmidae) in open waters in R. Macedonia
Figure 6. Light micrograph of the ovaries of a female P. nattereri. H&E. Bar line = 0.1mm.
Table 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
<p><b>Table 1:</b> Details of target genes (<i>hif-1α</i>, <i>hsp70</i>, <i>ras</i>, <i>mstn</i>, <i>acly</i>, <i>per-1</i>, <i>cry-1</i>, <i>ube3a</i> and <i>ogt</i>) and reference genes (<i>β- tubulin</i> and <i>β- actin</i>) primers.</p><table><tbody><tr><th><b>Gene</b></th><th><b>Length (bp)</b></th><th><b>R</b> <b>2</b></th><th><b>Efficiency (%)</b></th><th><b>Primers sequence (5ʹ-3ʹ) forward/reverse</b></th></tr></tbody><tbody><tr><th><i>tubulin</i> -F</th><td>20</td><td>0.99</td><td>109.5</td><td>GACGTGGTGCCCAAAGATGT</td></tr><tr><th><i>tubulin</i> -R</th><td>18</td><td>TGGATGGTGCGCTTGGT</td></tr><tr><th><i>β- actin</i> -F</th><td>21</td><td>0.99</td><td>100.5</td><td>GCTGTTTTCCCCTCCATTGTT</td></tr><tr><th><i>β- actin</i> -R</th><td>19</td><td>TCCCATGCCAACCATCACT</td></tr><tr><th><i>hif-1α</i> -F</th><td>20</td><td>0.99</td><td>105.2</td><td>CTTCTGAGCTCTGATGAGGC</td></tr><tr><th><i>hif-1α</i> -R</th><td>20</td><td>GAAAGCACCATCAGGAAGCC</td></tr><tr><th><i>hsp-70</i> -F</th><td>20</td><td>0.99</td><td>100.9</td><td>GCAAGGAGAACAAGATCACC</td></tr><tr><th><i>hsp-70</i> -R</th><td>19</td><td>CACTCCGTTGCACTTGTCC</td></tr><tr><th><i>mstn</i> -F</th><td>20</td><td>0.98</td><td>100.5</td><td>AATCCAAGCGAGGGAAAAGC</td></tr><tr><th><i>mstn</i> -R</th><td>22</td><td>CCTCCATCACCTGAAAGGTCTT</td></tr><tr><th><i>ras</i> -F</th><td>20</td><td>0.97</td><td>99.31</td><td>CCAGTACATGAGGACAGGAG</td></tr><tr><th><i>ras</i> -R</th><td>20</td><td>CAAGCACCATTGGCACATCG</td></tr><tr><th><i>acly</i> -F</th><td>19</td><td>0.99</td><td>100.7</td><td>ATCATCTCCCGCACTACAG</td></tr><tr><th><i>acly</i> -R</th><td>19</td><td>TACCTCCAATCTCTCCCAG</td></tr><tr><th><i>ube3a</i> -F</th><td>21</td><td>0.98</td><td>103.3</td><td>GCCATAAGCAAGCAGCACAAC</td></tr><tr><th><i>ube3a</i> -R</th><td>19</td><td>CCAGTCAGTCCGCACATCG</td></tr><tr><th><i>per-1</i> -F</th><td>20</td><td>0.98</td><td>104.1</td><td>TGTTGAAGTTTGTGCCCCAG</td></tr><tr><th><i>per-1</i> -R</th><td>18</td><td>CAGTCCAGATGCTCCTCC</td></tr><tr><th><i>cry-1</i> -F</th><td>19</td><td>0.99</td><td>103.6</td><td>GTCCAACAGCCCTCAAACT</td></tr><tr><th><i>cry-1</i> -R</th><td>18</td><td>TACGCCAAGCACTCCAGA</td></tr><tr><th><i>ogt</i> -F</th><td>19</td><td>0.99</td><td>104.1</td><td>CCTCCCTTTGCTGTGTTCC</td></tr><tr><th><i>ogt</i> -R</th><td>20</td><td>TGTCTGCTTTCCGCTTTCGC</td></tr></tbody></table>
Fig. 5. Correlation between the fibers diameters and body weight from 300 in Morphological and morphometric analysis of skeletal muscle between male and female young adult Colossoma macropomum (Characiformes: Serrasalmidae)
Fig. 5. Correlation between the fibers diameters and body weight from 300 days old Colossoma macropomum. The fibers diameters are showed by class: circle (<20 µm), triangle (20 to 50 µm) and square (>50 µm).
Fig. 1 in Morphological and morphometric analysis of skeletal muscle between male and female young adult Colossoma macropomum (Characiformes: Serrasalmidae)
Fig. 1. Muscle tissue organization in Colossoma macropomum. A. Multinucleated fibers with peripheral nuclei (arrow). Longitudinal section. HE. (Bar = 25 μm). B. Nuclei located at the periphery of the muscle fiber (arrow). Transverse section. HE. (Bar = 50 μm). C. Fascicle organized in perimysium and endomysium. Transverse section. HE. (Bar = 100 μm). D. Connective tissue surrounding the endomysium (dotted arrow) and perimysium (black arrow). Transverse section. Masson trichrome. (Bar = 50 μm). E. Mobilization of cells in the muscle fiber insertion in connective tissue (black arrow), many nuclei are observed. Longitudinal section. HE. (Bar = 50 μm). F. Sarcomere with striations along the muscle fiber. Longitudinal section. HE. (Bar = 25 μm).
Fig. 4 in Morphological and morphometric analysis of skeletal muscle between male and female young adult Colossoma macropomum (Characiformes: Serrasalmidae)
Fig. 4. Frequency of muscle fibers from 300 days old Colossoma macropomum. Significant differences (*) represent the differences between the animal groups according to body weight, 165 to 300 g (black) and 976 to 1,250 g (gray) in each class by ANOVA one-way supplemented by Tukey's test (P<0.05).
Fig. 3. A in Morphological and morphometric analysis of skeletal muscle between male and female young adult Colossoma macropomum (Characiformes: Serrasalmidae)
Fig. 3. A. Cellular apoptosis (black arrow). Transverse section. Masson trichrome. (Bar = 25 μm). B. Detail of the nerve (black circle). Transverse section. Masson trichrome. (Bar = 50 μm).
FIGURE 5 in A new large Myloplus Gill 1896 from rio Negro basin, Brazilian Amazon (Characiformes: Serrasalmidae)
FIGURE 5. Geographic distribution of Myloplus lucienae in rio Negro basin, Brazil. Squares can represent more than one lot. Star: type locality..
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.