Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
66
datasets available to search
ShareScore release 0.9.0
Dataset results
66 results for “timeseries”
Treeline data based on analysis of timeseries of aerial imagery over Samaria National Park
<p>The dataset is about the occurence of individual trees at the treeline in four locations in Samaria National Park</p>
Identification of a new gene regulatory circuit involving B cell receptor activated signaling using a combined analysis of experimental, clinical and global gene expression data [timeSeries]
GEO Series GSE71721. Homo sapiens. 33 samples. Type: Expression profiling by array.
Land/Ocean Biogeochemical Observatory (LOBO) water quality monitoring system timeseries
Measurements made near Dartmouth, Nova Scotia in 2009.
RNA-Seq timeseries of Adventitious root development in Populus ussuriensis
GEO Series GSE117619. Populus ussuriensis. 8 samples. Type: Expression profiling by high throughput sequencing.
Fr1_timeseries
Open the record for dataset details and reuse information.
sRNA_seq_clean_thrips_leafdiscs_timeseries
<p>2023-03 Timeseries experiment with clean thrips on leafdiscs of tomato MoneyMaker plants. srna and mrna were extracted with the kit 'NucleoSpin miRNA, Mini kit for miRNA and RNA purification'.<br> contains (see metadata file for more info):</p> <p>- 20x leafdiscs samples as controls (5 biological replicates/wells for 4 timepoints: 3h, 6h, 9h, 12h)</p> <p>- 20x leafdiscs samples with thrips (5 biological replicates/wells for 4 timepoints: 3h, 6h, 9h, 12h)</p> <p>- 5x whole thrips feeding on leafdiscs for 12h (same experiment, as leafdiscs)</p> <p>- 2x the heads of thrips feeding on tomato for 24h+, i.e. salivary glands enriched samples</p> <p>- 2x the eggs of thrips</p> <p>Barcoded Small RNA-Seq libraries were generated from the small RNA according to the manufacturers’ protocols using the Small RNA-Seq Library Prep Kit (Lexogen). The size distribution of the libraries with indexed adapters was assessed using a 2200 TapeStation System with Agilent D1000 ScreenTapes (Agilent Technologies). The libraries were quantified on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) using the NEBNext Library Quant Kit for Illumina (New England BioLabs) according to the instructions of the manufacturer. The libraries were clustered and sequenced (75 bp) on a NextSeq 550 Sequencing System (Illumina) using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina). </p> <p>Adapter: TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC</p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.