Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
1,298
datasets available to search
ShareScore release 0.9.0
Dataset results
1,298 results for “archives”
NMR FID archive for "Improved synthesis of two quisqualic acid analogs containing hydantoin and imidazolidinone moieties"
<p>NMR FID collection for the manuscript "<strong>Improved synthesis of two quisqualic acid analogs containing hydantoin and imidazolidinone moieties</strong>"</p>
Figure 7 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 7 Scheme with overview of PCR attempts to recover the barcoding region of cytochrome c oxidase subunit I with novel primers from archival specimens from the genera Aphidius, Praon, Lysiphlebus, Ephedrus and Monoctonus. Primer pairs coloured red were used in direct PCR; black coloured primers were used in secondary nested reactions. Positions where short fragments within the subsequences overlap are marked with a pattern.
Figure 3 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 3 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Praon samples. Three direct PCR reactions were conducted with primer pairs: 1. LCO1490/Pr1Rd, 2. Pr2Fd/Pr2Rd, 3. Pr3Fd/HCO2198. The species included in trials are PF1- P. volucre, PF2- P. dorsale, PF3- P. abjectum; M – marker.
Figure 6 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 6 Agarose gel visualizing the products of nested trials with products of direct PCR for samples LD8 – L. confusus, LD9 – L. desertorum; LD12 – L. fabarum; and LD13 – L. alpinus. The products of LD8 and LD9 from PCR with LCO1490/Lys1Rd were submitted to secondary reactions combining two primer pairs, viz., 1. LCO1490/Lys1Rn; and 2. Lys1Fn/Lys1Rd. Amplicons of LD8, LD9 and LD12 obtained with Aph2Fd/Lys2Rd were submitted to secondary nested trials with primer pairs Aph2Fd/Lys2Rn and Lys2Fn/Lys2Rd. Products from direct PCR with Lys3Fd/HCO2198 were used as the template for nested reactions with Lys3Fd/Aph3Rn and Lys3Fn/HCO2198.
Figure 5 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 5 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Lysiphlebus samples. Tested combinations of primers were: 1) LCO1490/Lys1Rd; 2) Aph2Fd/Lys2Rd; 3) Pr2Fd/Lys2Rd; and 4) Lys3Fd/HCO2198. The species included in trials were: LF1 - L. hirticornis; LF2 - L. cardui; and LF3 - L. fabarum; M – marker.
Figure 4 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 4 Agarose gel visualizing the products of nested trials with products of direct PCR for samples PD12 - P. barbatum, PD14 - P. yomenae, and PD15 - P. yomenae. The products from PCR with Pr2Fd/Pr2Rd were submitted to secondary nested trials with primer pairs Pr2Fd/Pr2Rn and Aph2Fn/Pr2Rd. Amplicons obtained with Pr3Fd/HCO2198 were used as the template for nested reactions with Pr3Fd/Pr3Rn and Pr3Fn/HCO2198.
Figure 1 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 1 Position of internal degenerative primers within the barcoding region of COI. Aphidius - specific primers: Aph1Fn, Aph1Rn, Aph1Rd, Aph2Fd, Aph2Fn, Aph2Rn, Aph2Rd, Aph3Fd, Aph3Fn and Aph3Rn; Lysiphlebus - specific primers: Lys1Fn, Lys1Rd, Lys2Fn, Lys2Rn, Lys2Rd, Lys3Fd and Lys3Fn; Praon - specific primers: Pr1Fn, Pr1Rn, Pr1Rd, Pr2Fd, Pr2Rn, Pr2Rd, Pr3Fd, Pr3Fn and Pr3Rn. Arrows refer to the direction of the primers, forward or reverse. The exact position of internal primers is designated in comparison to the first nucleotide of the forward LCO1490 primer sequence (5' GGTCAACAAATCATAAAGATATTGG 3').
Figure 2 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 2 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Aphidius samples. Three direct PCR reactions were conducted with the following primer pairs: 1 LCO1490/Aph1Rd 2 Aph2Fd/Aph2Rd; and 3 Aph3Fd/HCO2198. The species included in trials were: AF1- A. tanacetarius, AF2- A. sussi, AF3- A. sonchi, AF4- A. linosiphonis and AF5- A. ribis. M – marker.
Figure 8 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 8 The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model. The tree with the highest log likelihood is shown. There were a total of 568 positions in the final dataset. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The percentage of replicate trees >50% in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches.
Skeleton Test Suite and PRONOM Archive v94
<p>Skeleton Test Suite and PRONOM Archive v94</p>
FluView National, Regional, and State Level Outpatient Illness and Viral Surveillance 2017-2018 (archived by MIDAS-ISG)
<p>Description from the FluView Interactive web application (from which these files were downloaded):</p> <p>Viral Surveillance — Data collection from both the U.S. World Health Organization (WHO) Collaborating Laboratories and National Respiratory and Enteric Virus Surveillance System (NREVSS) laboratories began during the 1997-98 season. The volume of tested specimens has greatly increased during this time due to increased participation and increased testing. During the 1997-98 season 43 state public health laboratories participated in surveillance, and by the 2004-05 season all state public health laboratories were participating in surveillance. The addition of NREVSS data during the 1997-98 season roughly doubled the amount of virologic data reported each week. </p> <p>The number of specimens tested and % positive rate vary by region and season based on different testing practices including triaging of specimens by the reporting labs, therefore it is not appropriate to compare the magnitude of positivity rates or the number of positive specimens between regions or seasons. </p> <p>The U.S. WHO and NREVSS collaborating laboratories report the total number of respiratory specimens tested and the number positive for influenza types A and B each week to CDC. Most of the U.S. WHO collaborating laboratories also report the influenza A subtype (H1 or H3) of the viruses they have isolated, but the majority of NREVSS laboratories do not report the influenza A subtype. </p> <p>For more information on virologic surveillance please visit:http://www.cdc.gov/flu/weekly/overview.htm#Viral</p> <p>Outpatient Illness Surveillance — Information on patient visits to health care providers for influenza-like illness is collected through the U.S. Outpatient Influenza-like Illness Surveillance Network (ILINet). This collaborative effort between CDC, state and local health departments, and health care providers started during the 1997-98 influenza season when approximately 250 providers were enrolled. Enrollment in the system has increased over time and there were >3,000 providers enrolled during the 2010-11 season.</p> <p>The number and percent of patients presenting with ILI each week will vary by region and season due to many factors, including having different provider type mixes (children present with higher rates of ILI than adults, and therefore regions with a higher percentage of pediatric practices will have higher numbers of cases). Therefore it is not appropriate to compare the magnitude of the percent of visits due to ILI between regions and seasons.</p> <p>Baseline levels are calculated both nationally and for each region. Percentages at or above the baseline level are considered to be elevated.</p> <p>For more information on ILI surveillance and baselines please visit:http://www.cdc.gov/flu/weekly/overview.htm#Outpatient</p>
FluView National, Regional, and State Level Outpatient Illness and Viral Surveillance 2016-2017 (archived by MIDAS-ISG)
<p>Description from the FluView Interactive web application (from which these files were downloaded):</p> <p>Viral Surveillance — Data collection from both the U.S. World Health Organization (WHO) Collaborating Laboratories and National Respiratory and Enteric Virus Surveillance System (NREVSS) laboratories began during the 1997-98 season. The volume of tested specimens has greatly increased during this time due to increased participation and increased testing. During the 1997-98 season 43 state public health laboratories participated in surveillance, and by the 2004-05 season all state public health laboratories were participating in surveillance. The addition of NREVSS data during the 1997-98 season roughly doubled the amount of virologic data reported each week. </p> <p>The number of specimens tested and % positive rate vary by region and season based on different testing practices including triaging of specimens by the reporting labs, therefore it is not appropriate to compare the magnitude of positivity rates or the number of positive specimens between regions or seasons. </p> <p>The U.S. WHO and NREVSS collaborating laboratories report the total number of respiratory specimens tested and the number positive for influenza types A and B each week to CDC. Most of the U.S. WHO collaborating laboratories also report the influenza A subtype (H1 or H3) of the viruses they have isolated, but the majority of NREVSS laboratories do not report the influenza A subtype. </p> <p>For more information on virologic surveillance please visit:http://www.cdc.gov/flu/weekly/overview.htm#Viral</p> <p>Outpatient Illness Surveillance — Information on patient visits to health care providers for influenza-like illness is collected through the U.S. Outpatient Influenza-like Illness Surveillance Network (ILINet). This collaborative effort between CDC, state and local health departments, and health care providers started during the 1997-98 influenza season when approximately 250 providers were enrolled. Enrollment in the system has increased over time and there were >3,000 providers enrolled during the 2010-11 season.</p> <p>The number and percent of patients presenting with ILI each week will vary by region and season due to many factors, including having different provider type mixes (children present with higher rates of ILI than adults, and therefore regions with a higher percentage of pediatric practices will have higher numbers of cases). Therefore it is not appropriate to compare the magnitude of the percent of visits due to ILI between regions and seasons.</p> <p>Baseline levels are calculated both nationally and for each region. Percentages at or above the baseline level are considered to be elevated.</p> <p>For more information on ILI surveillance and baselines please visit:http://www.cdc.gov/flu/weekly/overview.htm#Outpatient</p>
FluView National, Regional, and State Level Outpatient Illness and Viral Surveillance 2015-2016 (archived by MIDAS-ISG)
<p>Description from the FluView Interactive web application (from which these files were downloaded):</p> <p>Viral Surveillance — Data collection from both the U.S. World Health Organization (WHO) Collaborating Laboratories and National Respiratory and Enteric Virus Surveillance System (NREVSS) laboratories began during the 1997-98 season. The volume of tested specimens has greatly increased during this time due to increased participation and increased testing. During the 1997-98 season 43 state public health laboratories participated in surveillance, and by the 2004-05 season all state public health laboratories were participating in surveillance. The addition of NREVSS data during the 1997-98 season roughly doubled the amount of virologic data reported each week. </p> <p>The number of specimens tested and % positive rate vary by region and season based on different testing practices including triaging of specimens by the reporting labs, therefore it is not appropriate to compare the magnitude of positivity rates or the number of positive specimens between regions or seasons. </p> <p>The U.S. WHO and NREVSS collaborating laboratories report the total number of respiratory specimens tested and the number positive for influenza types A and B each week to CDC. Most of the U.S. WHO collaborating laboratories also report the influenza A subtype (H1 or H3) of the viruses they have isolated, but the majority of NREVSS laboratories do not report the influenza A subtype. </p> <p>For more information on virologic surveillance please visit:http://www.cdc.gov/flu/weekly/overview.htm#Viral</p> <p>Outpatient Illness Surveillance — Information on patient visits to health care providers for influenza-like illness is collected through the U.S. Outpatient Influenza-like Illness Surveillance Network (ILINet). This collaborative effort between CDC, state and local health departments, and health care providers started during the 1997-98 influenza season when approximately 250 providers were enrolled. Enrollment in the system has increased over time and there were >3,000 providers enrolled during the 2010-11 season.</p> <p>The number and percent of patients presenting with ILI each week will vary by region and season due to many factors, including having different provider type mixes (children present with higher rates of ILI than adults, and therefore regions with a higher percentage of pediatric practices will have higher numbers of cases). Therefore it is not appropriate to compare the magnitude of the percent of visits due to ILI between regions and seasons.</p> <p>Baseline levels are calculated both nationally and for each region. Percentages at or above the baseline level are considered to be elevated.</p> <p>For more information on ILI surveillance and baselines please visit:http://www.cdc.gov/flu/weekly/overview.htm#Outpatient</p>
AgMIP's global gridded crop model intercomparison (GGCMI) phase II CTWN-A archive: priority 1 outputs from PROMET rice simulations
This data set contains output data from simulations with the model PROMET for rice as part of AgMIP's Global Gridded Crop Model Intercomparison (GGCMI) phase II output data set. Output variables included are: crop yield, above-ground biomass, planting day, maturity day, anthesis day, actual growing season evapotranspiration . Simulations are based on 31-year simulations using the ERA-Interim (Dee et al. 2011) data set with 4 atmospheric CO2 mixing ratios (C=360, 510, 660, 810 ppm) uniform offsets for temperature (T= -1, 0, 1, 2, 3, 4, 6 K), water (W= -50, -30, -20, -10, 0, 10, 20, 30 %, and infinite/irrigated), and 3 nitrogen input levels (N= 10, 60, 200 kgN/ha) using 2 assumptions on adaptation (A0= 'none', A1='regain original growing season').
Workflow Trace Archive askalon_ee2 trace
Trace description unavailable.
Workflow Trace Archive Pegasus_P5 trace
Trace description unavailable.
Workflow Trace Archive workflowhub_epigenomics_dataset-hep_grid5000_schema-0-2_epigenomics-hep-g5k-run001 trace
Workload downloaded from WorkflowHub, see http://workflowhub.isi.edu/.
Workflow Trace Archive workflowhub_epigenomics_dataset-ilmn_chameleon-cloud_schema-0-2_epigenomics-ilmn-100000-cc-run004 trace
Workload downloaded from WorkflowHub, see http://workflowhub.isi.edu/.
Workflow Trace Archive Pegasus_P8 trace
Trace description unavailable.
Workflow Trace Archive Pegasus_P1 trace
Trace description unavailable.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.