Find research datasets worth reusing

Fig. 2 in A comparative SEM study of the guard hair architecture in subterranean moles (Talpidae, Soricomorpha), golden moles (Chrysochloridae, Afrosoricidae), and silvery mole-rats (Bathyergidae, Rodentia)

Fig. 2. Architecture of guard hairs in an adult male of Talpa altaica. A, E, H – cross sections through the hair along the shaft from the hair base to the shield (left to right); B, F, I longitudinal sections through the hair along the shaft from the hair base to the shield (left to right); С – cuticular ornamentation along a shaft from the base to shield (left to right); D same along the shaft from the hair base to the region below the shield (top to bottom); G, J same along the shaft from the hair base to the shield (left to right). SEM micrographs. 10 μm scale.

Fig. 8 in A comparative SEM study of the guard hair architecture in subterranean moles (Talpidae, Soricomorpha), golden moles (Chrysochloridae, Afrosoricidae), and silvery mole-rats (Bathyergidae, Rodentia)

Fig. 8. Architecture of guard hairs in adult males of the studied species of Chrysospalax, Cryptochloris, and Eremitalpa. A – cross sections through a hair along the shaft from the hair base to the shield (from left to right); E same at the hair base and in the shield (left to right); H – same in the shield; B – longitudinal sections through a hair along the shaft at the hair base and in the shield (left to right); F, I – same in the shield; C – medulla in the shield; D, G, J – cuticular ornamentation along the shaft from the hair base to the shield (left to right). SEM micrographs. 10 μm scale.

Fig. 6 in A comparative SEM study of the guard hair architecture in subterranean moles (Talpidae, Soricomorpha), golden moles (Chrysochloridae, Afrosoricidae), and silvery mole-rats (Bathyergidae, Rodentia)

Fig. 6. Architecture of coarse hairs and guard hairs in an adult male of Urotrichus talpoides. A, D, G, J, M cross sections through a hair along the shaft, from the hair base to the shield (left to right, the flattening of the shaft is indicated by arrows); B, E, H, K, N longitudinal sections along the shaft, from the hair base to the shield (left to right); C, F, I, L, O – cuticular ornamentation along the shaft from the hair base to the shield (left to right, in F and I, the narrowing of the shaft is indicated by arrows). SEM micrographs. 10 μm scale.

Fig. 7 in A comparative SEM study of the guard hair architecture in subterranean moles (Talpidae, Soricomorpha), golden moles (Chrysochloridae, Afrosoricidae), and silvery mole-rats (Bathyergidae, Rodentia)

Fig. 7. Architecture of guard hairs in adult males of the studied species of Amblysomus, Calcochloris, Carpitalpa, and Chrysochloris. A, J – cross sections through a hair along the shaft from the hair base to the shield (left to right); E, M same in the shield; B – longitudinal sections of a hair along the shaft from the hair base to the shield (left to right); F, K, N – same in the shield; G, H, O – medullar architecture in the shield; C, I, L, P – cuticular ornamentation along the shaft from the hair base to the shield (left to right); D same at the hair tip. SEM micrographs. 10 μm scale.

Fig. 1 in A comparative SEM study of the guard hair architecture in subterranean moles (Talpidae, Soricomorpha), golden moles (Chrysochloridae, Afrosoricidae), and silvery mole-rats (Bathyergidae, Rodentia)

Fig. 1. Measuring protocol for the hair structures in the studied species: As – maximum surface area of the medullar air spaces; D – maximum shaft diameter; d – minimum shaft diameter; H –maximum length of the cuticular scale; h – maximum height of the transverse medullar septum - 'disk'; S – surface area of the hair cross section; s – surface area of the medullar column; hs – surface area of the septum -'disk'; W – shield width; w – maximum width of the medullar column in the shield. A flag ‒ diameter of the pigment granule.

Fig. 4 in A comparative SEM study of the guard hair architecture in subterranean moles (Talpidae, Soricomorpha), golden moles (Chrysochloridae, Afrosoricidae), and silvery mole-rats (Bathyergidae, Rodentia)

Fig. 4. Architecture of hairs in an adult male of Mogera robusta. A, D, K cross sections through a guard hair along the shaft from the hair base to the shield (left to right); B, E, H longitudinal sections through a guard hair; G cross sections through different hair types: coarse hair (arrow) and guard hairs; C, F, J – cuticular ornamentation of a guard hair from the hair base to the shield (left to right); I, L same in a coarse hair (left to right). SEM micrographs. 10 μm scale.

Fig. 10 in A comparative SEM study of the guard hair architecture in subterranean moles (Talpidae, Soricomorpha), golden moles (Chrysochloridae, Afrosoricidae), and silvery mole-rats (Bathyergidae, Rodentia)

Fig. 10. Visualization of metric data for guard hairs in the studied species. A – Talpidae and Bathyergidae, B – Chrysochloridae. Icon plots (graphs with pictograms in the form of profiles). Legend (left to right): D/d, base; D/d, shield; S/ s, W/w; W/h; As/hs; W/H, base/constriction, below shield, shield. Initial data are shown in tables 1Sup and 2Sup.

opennotspecifiedJan 2021View details →

Table 1 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species

Table 1. Primers used for PCR and sequencing<table><tbody><tr><th>Locus</th><th>Primer name</th><th>Primer sequences</th><th>Sense/anti-sense</th><th>Reference</th></tr></tbody><tbody><tr><th>CYT B</th><td>L14724_hk3</td><td>GGACTTATGACATGAAAAATCATCGTTG</td><td>Sense</td><td>He et al., 2010</td></tr><tr><td>H15915_hk3</td><td>GATTCCCCATTTCTGGTTTACAAGAC</td><td>Anti-sense</td><td>He et al., 2010</td></tr><tr><th>12S</th><td>L613_hk1</td><td>GGCGGGCGAGCAAAGCACTGAAAATG</td><td>Sense</td><td>He et al., 2010</td></tr><tr><td>H1478_hk1</td><td>TGATTGGTGGAGGGTGACGAGCGGTGTGT</td><td>Anti-sense</td><td>He et al., 2010</td></tr><tr><th>BRCA1</th><td>B1f</td><td>TGAGAACAGCACTTTATTACTCAC</td><td>Sense</td><td>Dubey et al., 2006</td></tr><tr><td>B1r</td><td>ATTCTAGTTCCATATTGCTTATACTG</td><td>Anti-sense</td><td>Dubey et al., 2006</td></tr><tr><th>APOB</th><td>ApoBf</td><td>GCAATCATTTGACTTAAGTG</td><td>Sense</td><td>Dubey et al., 2007</td></tr><tr><td>ApoBr</td><td>GAGCAACAATATCTGATTGG</td><td>Anti-sense</td><td>Dubey et al., 2007</td></tr><tr><th>RAG2</th><td>RAG2-F220</td><td>GATTCCTGCTAYCTYCCTCCTCT</td><td>Sense</td><td>Teeling et al., 2000</td></tr><tr><td>RAG2-R995</td><td>CCCATGTTGCTTCCAAACCATA</td><td>Anti-sense</td><td>Teeling et al., 2000</td></tr></tbody></table>

opennotspecifiedJan 2021View details →

Figure 2 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species

Figure 2. Dorsal, ventral and lateral views of the skull and lateral views of the mandible of the holotype of Alpiscaptulus medogensis (KIZ: 037966; left) and Scapanulus oweni (KIZ: 033872; right). Scale bar = 10 mm.

opennotspecifiedJan 2021View details →

Figure 5 in Morphology and phylogeny of scalopine moles (Eulipotyphla: Talpidae: Scalopini) from the eastern Himalayas, with descriptions of a new genus and species

Figure 5. Results of maximum likelihood phylogenetic analyses of concatenated (A) mitochondrial genes, (B) nuclear genes and (C) mitochondrial-nuclear trees. Node numbers indicate Bayesian posterior probabilities (PP) and ultrafast bootstrap supports (UFBoot). Branch lengths represent substitutions per site.

On following pages: 6. Snow Mountain Shrew Mole (Uropsilus nivatus); 7. Black-backed Shrew Mole (Uropsilus atronates (Scapanus orarius); 11. Townsend's Mole (Scapanus townsendii); 12. Broad-footed Mole (Scapanus latimanus); 13 fusicauda); 16. Japanese Shrew Mole (Urotrichus talpoides); 17. True's Shrew Mole (Dymecodon pilirostris); 18. American (Desmana moschata); 21. Pyrenean Desman (Galemys pyrenaicus). ); 8. Gansu Mole (Scapanulus owen); 9. Hairy-tailed Mole (Parascalops breweri); 10. Coast Mole. Mexican Mole (Scapanus anthonyi); 14. Eastern Mole (Scalopus aquaticus); 15. Long-tailed Mole (Scaptonyx Shrew Mole (Neurotrichus gibbsii); 19. Starnosed Mole (Condylura cristata); 20. Russian Desman in Talpidae

On following pages: 6. Snow Mountain Shrew Mole (Uropsilus nivatus); 7. Black-backed Shrew Mole (Uropsilus atronates (Scapanus orarius); 11. Townsend's Mole (Scapanus townsendii); 12. Broad-footed Mole (Scapanus latimanus); 13 fusicauda); 16. Japanese Shrew Mole (Urotrichus talpoides); 17. True's Shrew Mole (Dymecodon pilirostris); 18. American (Desmana moschata); 21. Pyrenean Desman (Galemys pyrenaicus). ); 8. Gansu Mole (Scapanulus owen); 9. Hairy-tailed Mole (Parascalops breweri); 10. Coast Mole. Mexican Mole (Scapanus anthonyi); 14. Eastern Mole (Scalopus aquaticus); 15. Long-tailed Mole (Scaptonyx Shrew Mole (Neurotrichus gibbsii); 19. Starnosed Mole (Condylura cristata); 20. Russian Desman

Distribution. NE & C China (Inner Mongolia [= Nei Mongol], Heilongjiang, Gansu, Ningxia, Shaanxi, Shanxi, Hebei, Beijing, Liaoning, Henan, Shandong, and Jiangsu); probably Mongolia. in Talpidae

Distribution. NE & C China (Inner Mongolia [= Nei Mongol], Heilongjiang, Gansu, Ningxia, Shaanxi, Shanxi, Hebei, Beijing, Liaoning, Henan, Shandong, and Jiangsu); probably Mongolia.

Distribution. NE India (Assam, Meghalaya, Nagaland, Manipur, Tripura, and Mizoram), Bangladesh, Myanmar (= Burma), and China (Sichuan and Yunnan); probably in Arunachal Pradesh, N of Brahmaputra River, and N Laos. in Talpidae

Distribution. NE India (Assam, Meghalaya, Nagaland, Manipur, Tripura, and Mizoram), Bangladesh, Myanmar (= Burma), and China (Sichuan and Yunnan); probably in Arunachal Pradesh, N of Brahmaputra River, and N Laos.

Subspecies and Distribution. E.p.parvidensG.S.Miller,1940—SVietnam. E. p. ngoclinhensis Zemlemerova et al., 2016 — C highlands of Vietham (Quang Nam and Kon Tum provinces). Euroscaptor parvidens was reportedly found in S Yunnan (China), but the species identification should be reevaluated. in Talpidae

Subspecies and Distribution. E.p.parvidensG.S.Miller,1940—SVietnam. E. p. ngoclinhensis Zemlemerova et al., 2016 — C highlands of Vietham (Quang Nam and Kon Tum provinces). Euroscaptor parvidens was reportedly found in S Yunnan (China), but the species identification should be reevaluated.

On following pages: 25. Ognev's Mole (Talpa ognevi); 26. Caucasian Mole (Talpa caucasica); 27. Levant Mole (Talpa 31. Iberian Mole (Talpa occidentalis); 32. European Mole (Talpa europaea); 33. Aquitanian Mole (Talpa aquitania); 34 Mole (Mogera wogura); 37. Small Japanese Mole (Mogera imaizumii); 38. Sado Mole (Mogera tokudae); 39. Echigo Mole (Mogera kanoana); 43. La Touche's Mole (Mogera latouchel); 44. Himalayan Mole (Euroscaptor micrurus); 45 (Euroscaptor klossi); 48. Kuznetsov's Mole (Euroscaptor kuznetsovi); 49. Orlov''s Mole (Euroscaptor orlovi); 50. Vietnamese (Euroscaptor malayanus); 53. White-tailed Mole (Parascaptor leucurus); 54. Short-faced Mole (Scaptochirus moschatus levantis); 28. Balkan Mole (Talpa stankovici); 29. Blind Mole (Talpa caeca); 30. Roman Mole (Talpa romana);. Japanese Mountain Mole (Oreoscaptor mizura); 35. Ussuri Mole (Mogera robusta); 36. Large Japanese Mole (Mogera etigo); 40. Senkaku Mole (Mogera uchidai); 41. Insular Mole (Mogera insularis); 42. Kano's . Greater Chinese Mole (Euroscaptor grandis); 46. Long-nosed Mole (Euroscaptor longirostris); 47. Kloss's Mole Mole (Euroscaptor subanura); 51. Small-toothed Mole (Euroscaptor parvidens); 52. Malaysian Mole). in Talpidae

On following pages: 25. Ognev's Mole (Talpa ognevi); 26. Caucasian Mole (Talpa caucasica); 27. Levant Mole (Talpa 31. Iberian Mole (Talpa occidentalis); 32. European Mole (Talpa europaea); 33. Aquitanian Mole (Talpa aquitania); 34 Mole (Mogera wogura); 37. Small Japanese Mole (Mogera imaizumii); 38. Sado Mole (Mogera tokudae); 39. Echigo Mole (Mogera kanoana); 43. La Touche's Mole (Mogera latouchel); 44. Himalayan Mole (Euroscaptor micrurus); 45 (Euroscaptor klossi); 48. Kuznetsov's Mole (Euroscaptor kuznetsovi); 49. Orlov''s Mole (Euroscaptor orlovi); 50. Vietnamese (Euroscaptor malayanus); 53. White-tailed Mole (Parascaptor leucurus); 54. Short-faced Mole (Scaptochirus moschatus levantis); 28. Balkan Mole (Talpa stankovici); 29. Blind Mole (Talpa caeca); 30. Roman Mole (Talpa romana);. Japanese Mountain Mole (Oreoscaptor mizura); 35. Ussuri Mole (Mogera robusta); 36. Large Japanese Mole (Mogera etigo); 40. Senkaku Mole (Mogera uchidai); 41. Insular Mole (Mogera insularis); 42. Kano's . Greater Chinese Mole (Euroscaptor grandis); 46. Long-nosed Mole (Euroscaptor longirostris); 47. Kloss's Mole Mole (Euroscaptor subanura); 51. Small-toothed Mole (Euroscaptor parvidens); 52. Malaysian Mole).

Distribution. NE Vietnam (Cao Bang and Vinh Phuc provinces), also S China (recently found in Yunnan and Jiangxi). in Talpidae

Distribution. NE Vietnam (Cao Bang and Vinh Phuc provinces), also S China (recently found in Yunnan and Jiangxi).

Distribution. SW China (W Yunnan) and NW Vietnam (Lao Cai Province); possibly from N Laos E to N Vietnam, W of Red River. in Talpidae

Distribution. SW China (W Yunnan) and NW Vietnam (Lao Cai Province); possibly from N Laos E to N Vietnam, W of Red River.

Distribution. C & S in Talpidae

Distribution. C & S China (Gansu, Shaanxi, Sichuan, Chongqing, Guizhou, Hubei, Hunan, Guangxi, Jiangxi, and Fujian).

Distribution. SC China (C Sichuan and W Yunnan); probably in adjacent Myanmar (= Burma) but no confirmed records. in Talpidae

Distribution. SC China (C Sichuan and W Yunnan); probably in adjacent Myanmar (= Burma) but no confirmed records.

Subspecies and Distribution. M.i.insularisSwinhoe,1863—Taiwan. M. i. hainana Thomas, 1910 — Hainan I (China). in Talpidae

Subspecies and Distribution. M.i.insularisSwinhoe,1863—Taiwan. M. i. hainana Thomas, 1910 — Hainan I (China).