Find research datasets worth reusing

opennotspecifiedDec 2020View details →

Figs 1–10 in The first Mesozoic Derbidae (Homoptera: Fulgoroidea) from Cretaceous Burmese amber

Figs 1–10. Derbachile hochae gen. et sp.n., holotype male, Burmese amber: 1 — habitus, dorsal; 2 — habitus, ventral; 3 — head and thorax, dorsal; 4 — head and thorax, ventral (arrows, subantennal ridges); 5 — tegmen, anterodorsal; 6–7 — C and stigmal cell: 6 — right, 7 — left tegmen; 8 — hind legs; 9 — genitalia, ventral; 10 — genitalia, dorsal. Scale bars: 0.5 mm. Рис. 1–10. Derbachile hochae gen. et sp.n., голотип, самец, бирманский Янтарь: 1 — обЩий вид, сверху; 2 — обЩий вид, сниЗу; 3 — голова и грудь, сверху; 4 — голова и грудь, сниЗу (стрелки — подусиковые кили); 5 — переднее крыло, спереди-сверху; 6–7 — C и стигмальнаЯ Ячейка: 6 — правое переднее крыло, 7 — левое переднее крыло; 8 — Задние ноги; 9 — гениталии, сниЗу; 10 — гениталии, сверху. Длина масШтабной линейки: 0,5 мм.

FIGURE 7 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 7. Maximum Likelihood phylogenetic trees based on 1000 replicates; A) 18S rRNA, B) D9-D10 expansion region of 28S rRNA, C) 5' region of COI, and D) consensus tree for concatenated sequence data for all three loci; scale bar = percent nucleotide difference.

FIGURE 2 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 2. Adult male habitus of Platocerella sordida sp. nov.; A) dorsal view and B) lateral view; scale bar = 1 mm.

FIGURE 4 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 4. Forewing venation of Platocerella sordida sp. nov.; black text = vein and italic text = crossvein.

FIGURE 3 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 3. Adult male of Platocerella sordida sp. nov.; A) dorsal view of head, pronotum and mesonotum, B) lateral view of head, pronotum and mesonotum and C) frontal view of head; scale bar = 1 mm.

FIGURE 6 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 6. Aedeagus of Platocerella sordida sp. nov.; A) right lateral view, B) left lateral view, C) dorsal view, and D) ventral view.

FIGURE 5 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 5. Adult male genitalia of Platocerella sordida sp. nov.; A) left lateral view, B) ventral view, and C) dorsal view.

FIGURES 1–8 in A new genus from southern China in the tribe Nicertini and discussion of distinguishing tribes of Derbinae (Hemiptera: Fulgoromorpha: Derbidae)

FIGURES 1–8. Neomegatropis rubrimacula, sp. nov., adult. 1. male, head and thorax, dorsal view; 2. male, head and thorax, ventral view; 3. male, head and thorax, lateral view; 4. male, habitus, lateral view;5. female, head and thorax, dorsal view; 6. female, head and thorax, ventral view; 7. female, head and thorax, lateral view; 8. female, habitus, lateral view. Scale bars = 1 mm

FIGURES 22–28 in A new genus from southern China in the tribe Nicertini and discussion of distinguishing tribes of Derbinae (Hemiptera: Fulgoromorpha: Derbidae)

FIGURES 22–28. Neomegatropis rubrimacula, sp. nov., adult. 22. tegmen; 23. male, anal tube, dorsal view; 24. pygofer, ventral view; 25. gonostylus, lateral view; 26. aedeagus, lateral view; 27. female, anal tube, dorsal view; 28. gonoplac, laterodorsal view. Scale bars = 0.1 mm

FIGURES 9–21 in A new genus from southern China in the tribe Nicertini and discussion of distinguishing tribes of Derbinae (Hemiptera: Fulgoromorpha: Derbidae)

FIGURES 9–21. Neomegatropis rubrimacula, sp. nov., adult. 9. jugal margin of hind wing; 10. female, apical part of abdomen, lateral view; 11. female, apical part of abdomen, ventral view; 12. male, metatibiotarsal formula; 13. female, metatibiotarsal formula; 14. eggs; 15. female, anal tube, dorsal view; 16. female, anal tube, lateral view; 17. female, anal tube, laterodorsal view; 18. anterior connective lamina of gonapophysis VIII and endogonocoxal process, lateroventral view; 19. endogonocoxal process and gonocoxa VIII; 20. gonapophyses IX, ventral view; 21. gonapophyses IX, laterodorsal view. Scale bars = 0.2 mm

TABLE 1 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

<p><b>TABLE 1.</b> Primers used to amplify loci used for assessment of <i>Shellenius serratus</i> <b>sp. nov.</b> and corresponding annealing temperatures and extension times.</p><table><tbody><tr><th>Primer Name</th><th>Gene</th><th>Sequence (5’→3’)</th><th>Annealing</th><th>Extension</th><th>Reference</th></tr></tbody><tbody><tr><th>LCO1490 HCO2198</th><td>COI</td><td>GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA</td><td>40&ring;C</td><td>1 min. 30 sec.</td><td>Folmer <i>et al.</i> 1994</td></tr><tr><th>18SACDN_F1 18SACDN_R1</th><td>18S</td><td>AGAGGGAGCCTGAGAAACG GGGCAGGGACGTAATCAAC</td><td>60&ring;C</td><td>1 min. 45 sec.</td><td>Bahder <i>et al.</i> 2023</td></tr><tr><th>V/Forward X/Reverse</th><td>28S</td><td>GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC</td><td>55°C</td><td>1 min. 30 sec.</td><td>Cryan <i>et al.</i> 2000</td></tr></tbody></table>

FIGURE 2 in A new species of planthopper in genus Herpis (Hemiptera: Derbidae) from lowland tropical rainforest in Costa Rica

FIGURE 2. Herpis albida; (A) adult, male lateral view, (B) head, frontal view, (C) terminalia, ventral view, (D) terminalia, lateral view, and (E) aedeagus, lateral view; scale bar = 1mm.

FIGURE 1 in A new species of planthopper in genus Herpis (Hemiptera: Derbidae) from lowland tropical rainforest in Costa Rica

FIGURE 1. Herpis metcalfi; (A) adult male, lateral view, (B) head, frontal view, (C) aedeagus, lateral view, (D) terminalia, lateral view, and (E) terminalia, ventral view; scale bar = 1mm.

FIGURE 13 in A new species of planthopper in genus Herpis (Hemiptera: Derbidae) from lowland tropical rainforest in Costa Rica

FIGURE 13. Maximum Likelihood consensus tree (1,000 replicates) based on COI and 18S sequence data for currently available Cenchreini planthoppers with Anotia firebugia (Otiocerini) as outgroup.

FIGURE 4 in A new species of planthopper in genus Herpis (Hemiptera: Derbidae) from lowland tropical rainforest in Costa Rica

FIGURE 4. Holotype of Oropuna orba (Stål) comb. n.; (A) head, frontal view, (B) body, dorsal view, (C) body, lateral view, (D) female pregenital plate, and (E) labels.

FIGURE 11 in A new species of planthopper in genus Herpis (Hemiptera: Derbidae) from lowland tropical rainforest in Costa Rica

FIGURE 11. Male Herpis soros sp. n. terminalia; (A) lateral view, (B) ventral view, and (C) dorsal view.

FIGURE 7 in A new species of planthopper in genus Herpis (Hemiptera: Derbidae) from lowland tropical rainforest in Costa Rica

FIGURE 7. Holotype of Oropuna fuscus comb. n; (A) body dorsal view, (B) body lateral view, (C) head frontal view, (D) labels, and (E) terminalia ventral view. (image credit Museum of Comparative Zoology, Harvard University, ©President and Fellows of Harvard College, used by permission).

FIGURE 3 in A new species of planthopper in genus Herpis (Hemiptera: Derbidae) from lowland tropical rainforest in Costa Rica

FIGURE 3. Herpis fuscovittata, holotype; (A) lateral view, (B) dorsal view, (C) head frontal view, and (D) labels.

FIGURE 9 in A new species of planthopper in genus Herpis (Hemiptera: Derbidae) from lowland tropical rainforest in Costa Rica

FIGURE 9. Adult Herpis soros sp. n.; (A) head and pronotum frontal view, (B) head, pronotum, and mesonotum lateral view, and (C) head, pronotum, and mesonotum dorsal view; scale = 1 mm.