Find research datasets worth reusing

opennotspecifiedMar 2016View details →

Fig. 5 in Examining the sensitivity of molecular species delimitations to the choice of mitochondrial marker

Fig. 5 Numbers of species delimited by different mitochondrial genes in GMYC analysis of three datasets: a cetaceans; b bears (Ursidae); and c European whitefish (Coregonus lavaretus) and allies. In each case, the value at which the horizontal axis crosses the vertical axis corresponds to the number of named species (47 cetaceans, 8 bears, 4 whitefish). Columns represent the number of species delimited in the most likely hypotheses identified by GMYC using individual genes, while error bars show the range of species counts found in the 95 % confidence set of species hypotheses generated by GMYC. Genes marked 'NS' did not provide sufficient evidence to reject the one-species null hypothesis (likelihood-ratio test, p> 0.05). Substantial variation is observed between delimitations given by different genes

opennotspecifiedOct 2012View details →

Fig. 4 in Systematics and phylogenetic species delimitation within Polinices s.l. (Caenogastropoda: Naticidae) based on molecular data and shell morphology

Fig. 4 NeighborNet network based on the concatenated data set (COI, 16S, 18S, 28S, H3). Bootstrap values are indicated

Figure 4 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Figure 4. The historical biogeography of Liphistius. A, chronogram and ancestral area reconstructions for Liphistius. The numbers in front of the names of taxa correspond to those in Table 1. B, distribution routes of the trang species group (red arrows) and the bristowei species group (blue arrows). Areas are as follows: A = Mainland Sibumasu; B = Peninsular Sibumasu; C = Inthanon region; D = Central basin; E = Bentong–Reaub suture zone; F = Sukhothai terrain; G = Chantaburi region; H = Indochina terrain (based on Metcalfe 2017); I = East Asia [the distributions of all heptatheline taxa combined into a single area (not shown)].

Figure 3 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Figure 3. Results of eight species delimitation methods. Each vertical bar represents a different delimitation method, and each horizontal bar represents a putative delimited species. Taxa 1–5 are each represented by only a single specimen. The colours in the phylogenetic tree represent Liphistius species groups, as follows: red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in Sibumasu; blue, trang group from localities in Indochina.

Figure 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Figure 2. Multi-locus phylogeny using Bayesian inference (BI) with 'GBLOCK partition' alignments. Dashed lines show incongruent clades between Bayesian inference and maximum likelihood (ML). Coloured branches on the tree correspond to Liphistius species groups as follows: red, birmanicus group; orange, linang group; yellow, bristowei group; purple, trang group from localities in Sibumasu; blue, trang group from localities in Indochina.

Figure 1 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Figure 1. Distribution map of Liphistius. A, sample collection localities. Numbered collection locations correspond to those in Table 1. B, geological terrain: Sibumasu in the west (purple) and Indochina in the east (blue).

opennotspecifiedMar 2018View details →

FIGURE 4 in Species delimitation in the genus Tamarix: Morphological and molecular data

FIGURE 4. NeighberNet diagram of combined molecular data. 1) Tamarix mascatensis, 2) T. arceuthoides, 3) T. kermanesis,4) T. tetragyna, 5) T. karkalensis 6) T. kotschyi respectively. Numbers above splits are bootstrap values.

opennotspecifiedMar 2018View details →

FIGURE 1 in Species delimitation in the genus Tamarix: Morphological and molecular data

FIGURE 1. Distribution map of the studied Tamarix species. 1) T. mascatensis, 2) T. arceuthoides, 3) T. kermanesis,4) T. tetragyna, 5) T. karkalensis 6) T. kotschyi respectively.

opennotspecifiedMar 2020View details →

FIGURE 3 in Species Delimitation In Rhabdosciadium (Apiaceae): Morphological and Molecular

FIGURE 3. WARD dendrogram of the studied populations based on ISSR markers. TCS network (Fig. 4) revealed that although species 1(R. straussii) is more distinct than the other two species but its accessions showed a high degree of intra-specific genetic variability as they are positioned in different places of the network.

opennotspecifiedMar 2020View details →

FIGURE 2 in Species Delimitation In Rhabdosciadium (Apiaceae): Morphological and Molecular

FIGURE 2. PCA plot based on both quantitative and qualitative morphological characters delimiting the studied species in Rhabdosciadium.

Table 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand

Table 2. Primers used and their annealing temperatures.<table><tbody><tr><th>Gene</th><th>Primer</th><th>Sequence (5 ʹ –3 ʹ)</th><th>Annealing temperature (°C)</th><th>Reference</th></tr></tbody><tbody><tr><th>CO1</th><td>LCO1490</td><td>GGTCAACAAATCATAAAGATATTGG</td><td>40</td><td>Folmer et al. (1994)</td></tr><tr><th></th><td>HCO2198</td><td>TAAACTTCAGGGTGACCAAAAAATCA</td><td>40</td><td>Folmer et al. (1994)</td></tr><tr><th>16S</th><td>16Sar</td><td>ATAGAGCTCCCATGGCGCCTGTTTAT CAAAAACAT</td><td>54</td><td>Huber et al. (1993)</td></tr><tr><th></th><td>16Sbr</td><td>ATAGAGCTCCCATGGCCGGTCTGAA CTCAGATCACGT</td><td>54</td><td>Huber et al. (1993)</td></tr><tr><th>ITS2</th><td>ITS-5.8S</td><td>GGGACGATGAAGAACGCAGC</td><td>47</td><td>White et al. (1990)</td></tr><tr><th></th><td>ITS-28S</td><td>TCCTCCGCTTATTGATATGC</td><td>47</td><td>White et al. (1990)</td></tr><tr><th>28S</th><td>28S-O</td><td>GAAACTGCTCAAAGGTAAACGG</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th></th><td>28S-C</td><td>GGTTCGATTAGTCTTTCGCC</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th>H3</th><td>H3aF</td><td>ATGGCTCGTACCAAGCAGACVGC</td><td>50</td><td>Colgan et al. (1998)</td></tr><tr><th></th><td>H3aR</td><td>ATATCCTTRGGCATRATRGTGAC</td><td>50</td><td>Colgan et al. (1998)</td></tr></tbody></table>

Figure 11. Phylogenetic relationships within the Xiphinema americanum-group complex. Bayesian 50 in Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers

Figure 11. Phylogenetic relationships within the Xiphinema americanum-group complex. Bayesian 50% majority rule consensus tree as inferred from partial cytochrome c oxidase subunit I (coxI) sequence alignment under a transversional of invariable sites and gamma-shaped distribution model TVM + I + G model. Posterior probabilities more than 65% are given for appropriate clades; bootstrap values greater than 50% are given on appropriate clades in the maximum likelihood analysis. Sequences newly obtained in this study in this study are in bold. Scale bar = expected changes per site.

Figure 7 in Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers

Figure 7. Factor analysis of 11 morphometric characters used to characterize Xiphinema plesiopachtaicum sp. nov., Xiphinema vallense sp. nov., and Xiphinema pachtaicum-subgroup species. Left-hand side of panels: projection of morphometric characters on the plane of factors 1 and 2 (A), 1 and 3 (B), 1 and 4 (C), and 2 and 3 (D). Abbreviations: L, body length; V, (distance from anterior end to vulva/body length) × 100; OaGR, oral aperture-guiding ring distance; Lip, lip region width; Tail, female tail length; Hyaline, hyaline region length; a, body length/maximum body width; b, body length/pharyngeal length; c, body length/tail length; c′, tail length/body width at anus.

Figure 6 in Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers

Figure 6. Light micrographs of Xiphinema astaregiense sp. nov. A, B, entire female and male, respectively. C–F, female neck region. G, pharyngeal bulb. H, vulval region. I–K, female tail regions from different specimens showing the morphological variability. L, M, male tail region, ventromedian supplements arrowed. Abbreviations: a, anus; gr, guiding ring; V, vulva. Scale bars: A, B = 200 μm; C–M = 20 μm.

Figure 4 in Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers

Figure 4. Light micrographs of Xiphinema vallense sp. nov. A, entire female. B, E, female neck region. C, D, F, female lip region. G, vulval region. H–M, female tail regions from different specimens showing the morphological variability. N–O, male tail, ventromedian supplements arrowed. Abbreviations: a, anus; gr, guiding ring; V, vulva. Scale bars: A = 200 μm; B–O = 20 μm.

Figure 3 in Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers

Figure 3. Light micrographs of Xiphinema plesiopachtaicum sp. nov. A, entire female. B, female neck region. C, D, female lip region. E, vulval region. F–K, female tail regions from different specimens showing the morphological variability. Abbreviations: a, anus; gr, guiding ring; V, vulva. Scale bars: A = 100 μm; B–K = 20 μm.

Figure 8 in Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers

Figure 8. Factor analysis of 11 morphometric characters used to characterize Xiphinema plesiopachtaicum sp. nov., Xiphinema vallense sp. nov., and Xiphinema pachtaicum-subgroup species. Projection of Xiphinema americanum- group species on the plane of factor 1 and 2 (A), 1 and 3 (B), 1 and 4 (C), and 2 and 3 (D).

Figure 1 in Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers

Figure 1. Line drawings of: A–D, Xiphinema plesiopachtaicum sp. nov.; E–H, Xiphinema vallense sp. nov.; I–L, Xiphinema astaregiense sp. nov. A, E, I, female lip regions. B–D, F, G, J, K, female tail regions. H, L, male tail regions.

Figure 2 in Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers

Figure 2. Line drawings of pharyngeal bulb and anterior genital branch of: A, B, Xiphinema plesiopachtaicum sp. nov.; C, D, Xiphinema vallense sp. nov.; E, F, Xiphinema astaregiense sp. nov.

Figure 10. Phylogenetic relationships within the Xiphinema americanum-group complex. Bayesian 50 in Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers

Figure 10. Phylogenetic relationships within the Xiphinema americanum-group complex. Bayesian 50% majority rule consensus tree as inferred from internal transcribed spacer 1 (ITS1) rRNA sequence alignment under the general timereversible and gamma-shaped distribution model. Posterior probabilities more than 65% are given for appropriate clades; bootstrap values greater than 50% are given on appropriate clades in the maximum likelihood analysis. Sequences newly obtained in this study are in bold. Scale bar = expected changes per site.