Find research datasets worth reusing

opennotspecifiedDec 2017View details →

FIGURE 1 in Molecular phylogeny of the genus Rhabdosciadium (Apiaceae) with description of a new species R. anatolyi from Hakkâri province, eastern Turkey

FIGURE 1 Bayesian analysis phylogenetic tree of nrITS nucleotide sequences. Posterior probability values and bootstrap values of maximum parsimony analysis are shown.

opennotspecifiedDec 2017View details →

FIGURE 4 in Molecular phylogeny of the genus Rhabdosciadium (Apiaceae) with description of a new species R. anatolyi from Hakkâri province, eastern Turkey

FIGURE 4 Distribution of Rhabdosciadium species: R. anatolyi (blue), R. aucheri (green), R. microcalycinum (purple), R. oligocarpum (red), R. petiolare (orange), R. straussii (yellow), R. urusakii (dark blue).

opennotspecifiedAug 2024View details →

Figure 1. The genus Autocrates. A in Molecular phylogeny of Trictenotomidae (Coleoptera: Tenebrionoidea): insights into species validation and biogeography of genus Autocrates

Figure 1. The genus Autocrates. A, global distribution and detailed discovery record in South Korea. B, Autocrates aeneus from Myanmar. C, Autocrates maqueti from South Korea. D, female oviposition of A. maqueti and L1 larvae (inner circle). E, mature larva of A. maqueti. F, pupa of A. maqueti.

opennotspecifiedAug 2024View details →

Figure 3 in Molecular phylogeny of Trictenotomidae (Coleoptera: Tenebrionoidea): insights into species validation and biogeography of genus Autocrates

Figure 3. Divergence time estimation and biogeographical analysis. The main figure shows the time tree of Trictenotomidae obtained from BEAST, and the horizontal bars on the nodes indicate 95% highest posterior density intervals for divergence time estimates. The pie charts above nodes indicate the relative probability of ancestral distribution at the corresponding node. Upper left box, biogeographical regions used in the present study. Upper right box, Palaeo-map of East Asia 3.5–0.8 Mya. The red dotted line indicates Min-Zhe uplift. Modified from Zhang et al. (2019). Abbreviations: CN, China; KR, South Korea.

opennotspecifiedAug 2024View details →

Figure 2 in Molecular phylogeny of Trictenotomidae (Coleoptera: Tenebrionoidea): insights into species validation and biogeography of genus Autocrates

Figure 2. Genetic analyses of Trictenotomidae. Upper left, population genetic structure of Autocrates maqueti obtained from TCS and TCSBU. Lower left, the distribution of A. maqueti populations and their genetic clusters inferred by COI data. The colour of each haplotype corresponds to the colours in the upper left. Right, molecular phylogenetic tree resulting from IQ-TREE and BEAST and the molecular species delimitation results. The left semicircle on the node represents the ultrafast bootstrap value, and the right semicircle represents the posterior probability. Black indicates a supporting value>95, grey>80 (and <95).

FIGURE 7 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 7. Maximum Likelihood phylogenetic trees based on 1000 replicates; A) 18S rRNA, B) D9-D10 expansion region of 28S rRNA, C) 5' region of COI, and D) consensus tree for concatenated sequence data for all three loci; scale bar = percent nucleotide difference.

FIGURE 2 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 2. Adult male habitus of Platocerella sordida sp. nov.; A) dorsal view and B) lateral view; scale bar = 1 mm.

FIGURE 4 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 4. Forewing venation of Platocerella sordida sp. nov.; black text = vein and italic text = crossvein.

FIGURE 3 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 3. Adult male of Platocerella sordida sp. nov.; A) dorsal view of head, pronotum and mesonotum, B) lateral view of head, pronotum and mesonotum and C) frontal view of head; scale bar = 1 mm.

FIGURE 6 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 6. Aedeagus of Platocerella sordida sp. nov.; A) right lateral view, B) left lateral view, C) dorsal view, and D) ventral view.

FIGURE 5 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 5. Adult male genitalia of Platocerella sordida sp. nov.; A) left lateral view, B) ventral view, and C) dorsal view.

opennotspecifiedJul 2024View details →

TABLE 1 in Molecular phylogeny and morphology reveal a new wood-inhabiting fungal species, Hyphoderma guangdongense (Polyporales, Basidiomycota), from China

TABLE 1. Names, voucher numbers, references, and corresponding GenBank accession numbers of sequences used in this study. (The new species are in bold, * is shown type material, - is shown data without used)<table><tbody><tr><th>Species name</th><th>Voucher number</th><th>GenBank accession number</th><th>References</th></tr></tbody><tbody><tr><th></th><td></td><td>ITS</td><td>nLSU</td><td></td></tr><tr><th>Diplomitoporus crustulinus Hyphoderma amoenum</th><td>FD-137 USO 286622</td><td>KP135299 HE577030</td><td>KP135211 -</td><td>Justo et al. 2017 Tellería et al. 2012</td></tr><tr><th>H. assimile</th><td>CBS:125852</td><td>MH863808</td><td>MH875272</td><td>Vu et al. 2019</td></tr><tr><th>H. cremeoalbum</th><td>NH 11538 (GB)</td><td>DQ677492</td><td>DQ677492</td><td>Larsson 2007</td></tr><tr><th>H. cremeoalbum</th><td>CLZhao 17007</td><td>OM985716</td><td>OM985753</td><td>Duan et al. 2023</td></tr><tr><th>H. crystallinum</th><td>CLZhao 9338</td><td>MW917161</td><td>MW913414</td><td>Guan & Zhao 2021a</td></tr><tr><th>H. crystallinum</th><td>CLZhao 9374</td><td>MW917162</td><td>MW913415</td><td>Guan & Zhao 2021a</td></tr><tr><th>H. definitum</th><td>NH 12266 (GB)</td><td>DQ677493</td><td>DQ677493</td><td>Larsson 2007</td></tr><tr><th>H. fissuratum</th><td>CLZhao 6731</td><td>MT791331</td><td>-</td><td>Ma et al. 2021</td></tr><tr><th>H. fissuratum</th><td>CLZhao 6726</td><td>MT791330</td><td>MT791334</td><td>Ma et al. 2021</td></tr><tr><th>H. floccosum</th><td>CLZhao 17129</td><td>MW301683</td><td>MW293733</td><td>Guan & Zhao 2021b</td></tr><tr><th>H. floccosum</th><td>CLZhao 17215</td><td>MW301687</td><td>MW293735</td><td>Guan & Zhao 2021b</td></tr><tr><th>H. granuliferum</th><td>5273</td><td>JN710545</td><td>JN710545</td><td>Yurchenko & Wu 2014b</td></tr><tr><th>H. guangdongense</th><td>CLZhao 12657</td><td>PP235513</td><td>PP235514</td><td>Present study</td></tr><tr><th>H. incrustatum</th><td>KHL6685</td><td>-</td><td>AY586668</td><td>Yurchenko & Wu 2014b</td></tr><tr><th>H. litschaueri</th><td>NH 7603 (GB)</td><td>DQ677496</td><td>DQ677496</td><td>Larsson 2007</td></tr><tr><th>H. litschaueri</th><td>FP-101740-Sp</td><td>KP135295</td><td>KP135219</td><td>Duan et al. 2023</td></tr><tr><th>H. macaronesicum</th><td>MA:Fungi 90388</td><td>KC984327</td><td>-</td><td>Unpublished</td></tr><tr><th>H. macaronesicum</th><td>TFC:Mic 15115</td><td>HE577011</td><td>-</td><td>Yurchenko & Wu 2014b</td></tr><tr><th>H. marginatum</th><td>CLZhao 3404</td><td>OM985717</td><td>OM985754</td><td>Duan et al. 2023</td></tr><tr><th>H. medioburiense</th><td>FD-335</td><td>KP135298</td><td>KP135220</td><td>Floudas & Hibbett 2015</td></tr><tr><th>H. membranaceum</th><td>CLZhao 5844</td><td>MW917167</td><td>MW913420</td><td>Guan & Zhao 2021a</td></tr><tr><th>H. membranaceum</th><td>CLZhao 6971</td><td>MW917168</td><td>MW913421</td><td>Guan & Zhao 2021a</td></tr><tr><th>H. microporoides</th><td>CLZhao 6857</td><td>MW917169</td><td>MW913422</td><td>Guan & Zhao 2021a</td></tr><tr><th>H. microporoides</th><td>CLZhao 8695</td><td>MW917170</td><td>MW913423</td><td>Guan & Zhao 2021a</td></tr><tr><th>H. moniliforme</th><td>Wu 0211-42</td><td>KC928282</td><td>-</td><td>Yurchenko & Wu 2015</td></tr><tr><th>H. moniliforme</th><td>Wu 0211-46</td><td>KC928284</td><td>-</td><td>Yurchenko & Wu 2015</td></tr><tr><th>H. mopanshanense</th><td>CLZhao 6498</td><td>MT791329</td><td>MT791333</td><td>Ma et al. 2021</td></tr><tr><th>H. mopanshanense</th><td>CLZhao 6449</td><td>OM985720</td><td>OM985759</td><td>Duan et al. 2023</td></tr><tr><th>H. nemorale</th><td>TNM F3931</td><td>KJ885183</td><td>KJ885184</td><td>Yurchenko & Wu 2015</td></tr><tr><th>H. nemorale</th><td>Wu 9508-14</td><td>KC928280</td><td>KC928281</td><td>Yurchenko & Wu 2015</td></tr><tr><th>H. niveomarginatum</th><td>CLZhao 25078</td><td>OR141728</td><td>OR506179</td><td>Yang et al. 2023</td></tr><tr><th>H. nudicephalum</th><td>Wu9307_29</td><td>AJ534269</td><td>-</td><td>Nilsson et al. 2003</td></tr><tr><th></th><td></td><td>ITS</td><td>nLSU</td><td></td></tr><tr><th>H. nudicephalum</th><td>CLZhao 17839</td><td>OM985721</td><td>OM985760</td><td>Duan et al. 2023</td></tr><tr><th>H. obtusiforme</th><td>KHL1464</td><td>JN572909</td><td>-</td><td>Yurchenko & Wu 2014a</td></tr><tr><th>H. obtusiforme</th><td>KHL11105</td><td>JN572910</td><td>-</td><td>Yurchenko & Wu 2014a</td></tr><tr><th>H. obtusum</th><td>JS17804</td><td>-</td><td>AY586670</td><td>Yurchenko & Wu 2014a</td></tr><tr><th>H. occidentale</th><td>KHL 8477 (GB)</td><td>DQ677499</td><td>DQ677499</td><td>Larsson 2007</td></tr><tr><th>H. paramacaronesicum</th><td>MA: Fungi 87736</td><td>KC984399</td><td>-</td><td>Martín et al. 2018</td></tr><tr><th>H. paramacaronesicum</th><td>MA: Fungi 87737</td><td>KC984405</td><td>-</td><td>Martín et al. 2018</td></tr><tr><th>H. prosopidis</th><td>ARIZ HHB 8479</td><td>HE577029</td><td>-</td><td>Yurchenko & Wu 2015</td></tr><tr><th>H. puerense</th><td>CLZhao 9476</td><td>MW443045</td><td>-</td><td>Guan et al. 2021</td></tr><tr><th>H. puerense</th><td>CLZhao 9583</td><td>MW443046</td><td>MW443051</td><td>Guan et al. 2021</td></tr><tr><th>H. setigerum *</th><td>FCUG 1200</td><td>AJ534273</td><td>-</td><td>Nilsson et al. 2003</td></tr><tr><th>H. setigerum *</th><td>FCUG 1688</td><td>AJ534272</td><td>-</td><td>Nilsson et al. 2003</td></tr><tr><th>H. sinense</th><td>CLZhao 7963</td><td>MW301679</td><td>MW293730</td><td>Guan & Zhao 2021b</td></tr><tr><th>H. sinense</th><td>CLZhao 17811</td><td>MW301682</td><td>MW293732</td><td>Guan & Zhao 2021b</td></tr><tr><th>H. sordidum</th><td>CLZhao 27379</td><td>OR141731</td><td>-</td><td>Yang et al. 2023</td></tr><tr><th>H. sordidum</th><td>CLZhao 27390</td><td>OR141732</td><td>OR506180</td><td>Yang et al. 2023</td></tr><tr><th>H. subsetigerum</th><td>HHB11620</td><td>GQ409521</td><td>-</td><td>Yurchenko & Wu 2014a</td></tr><tr><th>H. tenuissimum</th><td>CLZhao 7221</td><td>MW443049</td><td>MW443054</td><td>Guan et al. 2021</td></tr><tr><th>H. tenuissimum</th><td>CLZhao 16210</td><td>MW443050</td><td>MW443055</td><td>Guan et al. 2021</td></tr><tr><th>H. transiens</th><td>NH 12304 (GB)</td><td>DQ677504</td><td>DQ677504</td><td>Larsson 2007</td></tr><tr><th>H. tropicum</th><td>CLZhao 17308</td><td>OM985727</td><td>OM985768</td><td>Duan et al. 2023</td></tr><tr><th>H. variolosum</th><td>CBS: 734.91</td><td>MH862320</td><td>MH873992</td><td>Vu et al. 2019</td></tr><tr><th>H. variolosum</th><td>CBS: 735.91</td><td>MH862321</td><td>MH873993</td><td>Vu et al. 2019</td></tr><tr><th>H. weishanense</th><td>CLZhao 22403</td><td>OR141727</td><td>OR506181</td><td>Yang et al. 2023</td></tr></tbody></table>...continued on the next page

TABLE 1 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

TABLE 1. Primers used to amplify loci used for assessment of Shellenius serratus sp. nov. and corresponding annealing temperatures and extension times.<table><tbody><tr><th>Primer Name</th><th>Gene</th><th>Sequence (5’→3’)</th><th>Annealing</th><th>Extension</th><th>Reference</th></tr></tbody><tbody><tr><th>LCO1490 HCO2198</th><td>COI</td><td>GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA</td><td>40&ring;C</td><td>1 min. 30 sec.</td><td>Folmer et al. 1994</td></tr><tr><th>18SACDN_F1 18SACDN_R1</th><td>18S</td><td>AGAGGGAGCCTGAGAAACG GGGCAGGGACGTAATCAAC</td><td>60&ring;C</td><td>1 min. 45 sec.</td><td>Bahder et al. 2023</td></tr><tr><th>V/Forward X/Reverse</th><td>28S</td><td>GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC</td><td>55°C</td><td>1 min. 30 sec.</td><td>Cryan et al. 2000</td></tr></tbody></table>

FIGURE 6. A in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 6. A: Map showing geographic distribution of the subclade 2. B–D: Types of vegetation and environments of occurrence, B: "cerrado rupestre" (Chapada dos Veadeiros National Park, GO). C: "cerrado típico" (Serra do Cabral State Park, MG). D: "cerrado ralo" (Chapada dos Veadeiros National Park, GO). E–G: Typical morphology of members of the subclade 2, E: Upright shrub up to 4 m tall (C. claussenii var. claussenii). F: Stem with waxy bark (C. claussenii var. claussenii). G: Flower showing the adaxial petal resembles one of the upper lateral petals (C. claussenii var. megacycla). States: DF = Federal District, GO = Goiás, MG = Minas Gerais, MS = Mato Grosso do Sul, MT = Mato Grosso, TO = Tocantins.

FIGURE 8 in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 8. Diagnostic morphological characters of the species of the Paniculatae series: A: shrubby erect habit in Ch. claussenii. B: shrubby decumbent habit in Ch. ustulata. C: arboreal habit in Ch. orbiculata. D: longitudinally fissured bark in Ch. celiae. E: waxy bark in Ch. claussenii. F: alternate spiral leaves in Ch. claussenii. G: long and divaricate leaflets in Ch. claussenii. H: prominent veins on both sides and coriaceous in Ch. claussenii. I: inflorescence axes viscous in Ch. celiae. J: paniculate inflorescences in Ch. claussenii. K: racemous inflorescences in Ch. tocantinensis. L. asymmetric flowers with adaxial petal similar to a standard in Ch. orbiculata.

FIGURE 7 in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 7. Distribution area of species of the Paniculatae series, where BA = Bahia, BO = Bolívia, GO = Goiás, MG = Minas Gerais, MS = Mato Grosso do Sul, MT = Mato Grosso, PI = Piauí and TO = Tocantins.

FIGURE 4. A in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 4. A: Map showing geographic distribution of the subclade 1a. B-D: Types of vegetation and environments of occurrence, B: Transition between Cerrado and Caatinga (Grão Mogol State Park, MG). C: "cerrado típico" (Senador Modestino Gonçalves, MG). D: "cerrado típico" with rocky soil (Barrocão, MG). E-G: Typical morphology of members of the subclade 1a, E: Setulose paniculate inflorescence (Chamaecrista celiae). F: Leaf with two pairs of leaflets (C. orbiculata var. cercidifolia). G: Bud showing indumentum (C. orbiculata var. ustulata). States: MG = Minas Gerais.

FIGURE 5. A in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 5. A: Map showing geographic distribution of the subclade 1b. B-D: Types of vegetation and environments of occurrence, B: "cerrado rupestre" (Chapada dos Veadeiros National Park, GO). C: "cerrado típico" (Chapada dos Veadeiros National Park, GO). D: Cerrado drainage (Chapada dos Veadeiros National Park, GO). E-G: Typical morphology of members of the subclade 1b, E: Arboreous habit (C. orbiculata var. orbiculata). F: Shrubby habit (C. pachyclada). G: Leaf with more than two pairs of leaflets (C. orbiculata var. orbiculata). States: DF = Federal District, GO = Goiás.

FIGURE 3. A in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 3. A: Map showing geographic distribution of the subclade 1. B-D: Types of vegetation and environments of occurrence, B: "cerrado rupestre" (Chapada dos Veadeiros National Park, GO). C: Transition between Cerrado and Caatinga (Grão Mogol State Park, MG). D: "cerrado típico" (Serra Dourada State Park, GO). E-G: Typical morphology of member of the subclade 1 (Chamaecrista orbiculata), E: Habit. F: Detail of the stem with fissured bark, G: Paniculate inflorescence. States: BA = Bahia; DF = Federal District; GO = Goiás; MG = Minas Gerais; MS = Mato Grosso do Sul; MT = Mato Grosso; PI = Piauí; TO = Tocantins.

FIGURE 2 in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 2. Maximum clade credibility tree of the divergence time analysis (trnL-F + ITS) in BEAST. X-axis time scale in millions of years (My). Number in the nodes correspond to the mean age and blue bars correspond to 95% HPD (height posterior density). Clade highlighted in yellow correspond to clade Paniculatae. Subclades 1 and 2 and lineages 1a and 1b are discussed in the text.