Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

2,620

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

2,620 results for “Molecular phylogenies”

Learn how ShareScore rates datasets ↗
zenodo32/100

FIGURE 1 in Molecular phylogeny of the genus Rhabdosciadium (Apiaceae) with description of a new species R. anatolyi from Hakkâri province, eastern Turkey

FIGURE 1 Bayesian analysis phylogenetic tree of nrITS nucleotide sequences. Posterior probability values and bootstrap values of maximum parsimony analysis are shown.

opennotspecifiedDec 2017View details →
zenodo32/100

FIGURE 4 in Molecular phylogeny of the genus Rhabdosciadium (Apiaceae) with description of a new species R. anatolyi from Hakkâri province, eastern Turkey

FIGURE 4 Distribution of Rhabdosciadium species: R. anatolyi (blue), R. aucheri (green), R. microcalycinum (purple), R. oligocarpum (red), R. petiolare (orange), R. straussii (yellow), R. urusakii (dark blue).

opennotspecifiedDec 2017View details →
zenodo32/100

Figure 1. The genus Autocrates. A in Molecular phylogeny of Trictenotomidae (Coleoptera: Tenebrionoidea): insights into species validation and biogeography of genus Autocrates

Figure 1. The genus Autocrates. A, global distribution and detailed discovery record in South Korea. B, Autocrates aeneus from Myanmar. C, Autocrates maqueti from South Korea. D, female oviposition of A. maqueti and L1 larvae (inner circle). E, mature larva of A. maqueti. F, pupa of A. maqueti.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 3 in Molecular phylogeny of Trictenotomidae (Coleoptera: Tenebrionoidea): insights into species validation and biogeography of genus Autocrates

Figure 3. Divergence time estimation and biogeographical analysis. The main figure shows the time tree of Trictenotomidae obtained from BEAST, and the horizontal bars on the nodes indicate 95% highest posterior density intervals for divergence time estimates. The pie charts above nodes indicate the relative probability of ancestral distribution at the corresponding node. Upper left box, biogeographical regions used in the present study. Upper right box, Palaeo-map of East Asia 3.5–0.8 Mya. The red dotted line indicates Min-Zhe uplift. Modified from Zhang et al. (2019). Abbreviations: CN, China; KR, South Korea.

opennotspecifiedAug 2024View details →
zenodo32/100

Figure 2 in Molecular phylogeny of Trictenotomidae (Coleoptera: Tenebrionoidea): insights into species validation and biogeography of genus Autocrates

Figure 2. Genetic analyses of Trictenotomidae. Upper left, population genetic structure of Autocrates maqueti obtained from TCS and TCSBU. Lower left, the distribution of A. maqueti populations and their genetic clusters inferred by COI data. The colour of each haplotype corresponds to the colours in the upper left. Right, molecular phylogenetic tree resulting from IQ-TREE and BEAST and the molecular species delimitation results. The left semicircle on the node represents the ultrafast bootstrap value, and the right semicircle represents the posterior probability. Black indicates a supporting value>95, grey>80 (and <95).

opennotspecifiedAug 2024View details →
zenodo32/100

FIGURE 7 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 7. Maximum Likelihood phylogenetic trees based on 1000 replicates; A) 18S rRNA, B) D9-D10 expansion region of 28S rRNA, C) 5' region of COI, and D) consensus tree for concatenated sequence data for all three loci; scale bar = percent nucleotide difference.

opennotspecifiedSep 2024View details →
zenodo32/100

FIGURE 2 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 2. Adult male habitus of Platocerella sordida sp. nov.; A) dorsal view and B) lateral view; scale bar = 1 mm.

opennotspecifiedSep 2024View details →
zenodo32/100

FIGURE 4 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 4. Forewing venation of Platocerella sordida sp. nov.; black text = vein and italic text = crossvein.

opennotspecifiedSep 2024View details →
zenodo32/100

FIGURE 3 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 3. Adult male of Platocerella sordida sp. nov.; A) dorsal view of head, pronotum and mesonotum, B) lateral view of head, pronotum and mesonotum and C) frontal view of head; scale bar = 1 mm.

opennotspecifiedSep 2024View details →
zenodo32/100

FIGURE 6 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 6. Aedeagus of Platocerella sordida sp. nov.; A) right lateral view, B) left lateral view, C) dorsal view, and D) ventral view.

opennotspecifiedSep 2024View details →
zenodo32/100

FIGURE 5 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

FIGURE 5. Adult male genitalia of Platocerella sordida sp. nov.; A) left lateral view, B) ventral view, and C) dorsal view.

opennotspecifiedSep 2024View details →
zenodo32/100

TABLE 1 in Molecular phylogeny and morphology reveal a new wood-inhabiting fungal species, Hyphoderma guangdongense (Polyporales, Basidiomycota), from China

<p><b>TABLE 1.</b> Names, voucher numbers, references, and corresponding GenBank accession numbers of sequences used in this study. (The new species are in bold, * is shown type material, - is shown data without used)</p><table><tbody><tr><th><b>Species name</b></th><th><b>Voucher number</b></th><th><b>GenBank accession number</b></th><th><b>References</b></th></tr></tbody><tbody><tr><th></th><td></td><td><b>ITS</b></td><td><b>nLSU</b></td><td></td></tr><tr><th><i>Diplomitoporus crustulinus Hyphoderma amoenum</i></th><td>FD-137 USO 286622</td><td>KP135299 HE577030</td><td>KP135211 -</td><td>Justo <i>et al</i>. 2017 Teller&iacute;a <i>et al</i>. 2012</td></tr><tr><th><i>H. assimile</i></th><td>CBS:125852</td><td>MH863808</td><td>MH875272</td><td>Vu <i>et al</i>. 2019</td></tr><tr><th><i>H. cremeoalbum</i></th><td>NH 11538 (GB)</td><td>DQ677492</td><td>DQ677492</td><td>Larsson 2007</td></tr><tr><th><i>H. cremeoalbum</i></th><td>CLZhao 17007</td><td>OM985716</td><td>OM985753</td><td>Duan <i>et al</i>. 2023</td></tr><tr><th><i>H. crystallinum</i></th><td>CLZhao 9338</td><td>MW917161</td><td>MW913414</td><td>Guan &amp; Zhao 2021a</td></tr><tr><th><i>H. crystallinum</i></th><td>CLZhao 9374</td><td>MW917162</td><td>MW913415</td><td>Guan &amp; Zhao 2021a</td></tr><tr><th><i>H. definitum</i></th><td>NH 12266 (GB)</td><td>DQ677493</td><td>DQ677493</td><td>Larsson 2007</td></tr><tr><th><i>H. fissuratum</i></th><td>CLZhao 6731</td><td>MT791331</td><td>-</td><td>Ma <i>et al</i>. 2021</td></tr><tr><th><i>H. fissuratum</i></th><td>CLZhao 6726</td><td>MT791330</td><td>MT791334</td><td>Ma <i>et al</i>. 2021</td></tr><tr><th><i>H. floccosum</i></th><td>CLZhao 17129</td><td>MW301683</td><td>MW293733</td><td>Guan &amp; Zhao 2021b</td></tr><tr><th><i>H. floccosum</i></th><td>CLZhao 17215</td><td>MW301687</td><td>MW293735</td><td>Guan &amp; Zhao 2021b</td></tr><tr><th><i>H. granuliferum</i></th><td>5273</td><td>JN710545</td><td>JN710545</td><td>Yurchenko &amp; Wu 2014b</td></tr><tr><th><i>H. guangdongense</i></th><td><b>CLZhao 12657</b></td><td><b>PP235513</b></td><td><b>PP235514</b></td><td><b>Present study</b></td></tr><tr><th><i>H. incrustatum</i></th><td>KHL6685</td><td>-</td><td>AY586668</td><td>Yurchenko &amp; Wu 2014b</td></tr><tr><th><i>H. litschaueri</i></th><td>NH 7603 (GB)</td><td>DQ677496</td><td>DQ677496</td><td>Larsson 2007</td></tr><tr><th><i>H. litschaueri</i></th><td>FP-101740-Sp</td><td>KP135295</td><td>KP135219</td><td>Duan <i>et al</i>. 2023</td></tr><tr><th><i>H. macaronesicum</i></th><td>MA:Fungi 90388</td><td>KC984327</td><td>-</td><td>Unpublished</td></tr><tr><th><i>H. macaronesicum</i></th><td>TFC:Mic 15115</td><td>HE577011</td><td>-</td><td>Yurchenko &amp; Wu 2014b</td></tr><tr><th><i>H. marginatum</i></th><td>CLZhao 3404</td><td>OM985717</td><td>OM985754</td><td>Duan <i>et al</i>. 2023</td></tr><tr><th><i>H. medioburiense</i></th><td>FD-335</td><td>KP135298</td><td>KP135220</td><td>Floudas &amp; Hibbett 2015</td></tr><tr><th><i>H. membranaceum</i></th><td>CLZhao 5844</td><td>MW917167</td><td>MW913420</td><td>Guan &amp; Zhao 2021a</td></tr><tr><th><i>H. membranaceum</i></th><td>CLZhao 6971</td><td>MW917168</td><td>MW913421</td><td>Guan &amp; Zhao 2021a</td></tr><tr><th><i>H. microporoides</i></th><td>CLZhao 6857</td><td>MW917169</td><td>MW913422</td><td>Guan &amp; Zhao 2021a</td></tr><tr><th><i>H. microporoides</i></th><td>CLZhao 8695</td><td>MW917170</td><td>MW913423</td><td>Guan &amp; Zhao 2021a</td></tr><tr><th><i>H. moniliforme</i></th><td>Wu 0211-42</td><td>KC928282</td><td>-</td><td>Yurchenko &amp; Wu 2015</td></tr><tr><th><i>H. moniliforme</i></th><td>Wu 0211-46</td><td>KC928284</td><td>-</td><td>Yurchenko &amp; Wu 2015</td></tr><tr><th><i>H. mopanshanense</i></th><td>CLZhao 6498</td><td>MT791329</td><td>MT791333</td><td>Ma <i>et al</i>. 2021</td></tr><tr><th><i>H. mopanshanense</i></th><td>CLZhao 6449</td><td>OM985720</td><td>OM985759</td><td>Duan <i>et al</i>. 2023</td></tr><tr><th><i>H. nemorale</i></th><td>TNM F3931</td><td>KJ885183</td><td>KJ885184</td><td>Yurchenko &amp; Wu 2015</td></tr><tr><th><i>H. nemorale</i></th><td>Wu 9508-14</td><td>KC928280</td><td>KC928281</td><td>Yurchenko &amp; Wu 2015</td></tr><tr><th><i>H. niveomarginatum</i></th><td>CLZhao 25078</td><td>OR141728</td><td>OR506179</td><td>Yang <i>et al</i>. 2023</td></tr><tr><th><i>H. nudicephalum</i></th><td>Wu9307_29</td><td>AJ534269</td><td>-</td><td>Nilsson <i>et al.</i> 2003</td></tr><tr><th></th><td></td><td><b>ITS</b></td><td><b>nLSU</b></td><td></td></tr><tr><th><i>H. nudicephalum</i></th><td>CLZhao 17839</td><td>OM985721</td><td>OM985760</td><td>Duan <i>et al</i>. 2023</td></tr><tr><th><i>H. obtusiforme</i></th><td>KHL1464</td><td>JN572909</td><td>-</td><td>Yurchenko &amp; Wu 2014a</td></tr><tr><th><i>H. obtusiforme</i></th><td>KHL11105</td><td>JN572910</td><td>-</td><td>Yurchenko &amp; Wu 2014a</td></tr><tr><th><i>H. obtusum</i></th><td>JS17804</td><td>-</td><td>AY586670</td><td>Yurchenko &amp; Wu 2014a</td></tr><tr><th><i>H. occidentale</i></th><td>KHL 8477 (GB)</td><td>DQ677499</td><td>DQ677499</td><td>Larsson 2007</td></tr><tr><th><i>H. paramacaronesicum</i></th><td>MA: Fungi 87736</td><td>KC984399</td><td>-</td><td>Mart&iacute;n <i>et al</i>. 2018</td></tr><tr><th><i>H. paramacaronesicum</i></th><td>MA: Fungi 87737</td><td>KC984405</td><td>-</td><td>Mart&iacute;n <i>et al</i>. 2018</td></tr><tr><th><i>H. prosopidis</i></th><td>ARIZ HHB 8479</td><td>HE577029</td><td>-</td><td>Yurchenko &amp; Wu 2015</td></tr><tr><th><i>H. puerense</i></th><td>CLZhao 9476</td><td>MW443045</td><td>-</td><td>Guan <i>et al.</i> 2021</td></tr><tr><th><i>H. puerense</i></th><td>CLZhao 9583</td><td>MW443046</td><td>MW443051</td><td>Guan <i>et al</i>. 2021</td></tr><tr><th><i>H. setigerum</i> *</th><td>FCUG 1200</td><td>AJ534273</td><td>-</td><td>Nilsson <i>et al</i>. 2003</td></tr><tr><th><i>H. setigerum</i> *</th><td>FCUG 1688</td><td>AJ534272</td><td>-</td><td>Nilsson <i>et al</i>. 2003</td></tr><tr><th><i>H. sinense</i></th><td>CLZhao 7963</td><td>MW301679</td><td>MW293730</td><td>Guan &amp; Zhao 2021b</td></tr><tr><th><i>H. sinense</i></th><td>CLZhao 17811</td><td>MW301682</td><td>MW293732</td><td>Guan &amp; Zhao 2021b</td></tr><tr><th><i>H. sordidum</i></th><td>CLZhao 27379</td><td>OR141731</td><td>-</td><td>Yang <i>et al</i>. 2023</td></tr><tr><th><i>H. sordidum</i></th><td>CLZhao 27390</td><td>OR141732</td><td>OR506180</td><td>Yang <i>et al</i>. 2023</td></tr><tr><th><i>H. subsetigerum</i></th><td>HHB11620</td><td>GQ409521</td><td>-</td><td>Yurchenko &amp; Wu 2014a</td></tr><tr><th><i>H. tenuissimum</i></th><td>CLZhao 7221</td><td>MW443049</td><td>MW443054</td><td>Guan <i>et al</i>. 2021</td></tr><tr><th><i>H. tenuissimum</i></th><td>CLZhao 16210</td><td>MW443050</td><td>MW443055</td><td>Guan <i>et al</i>. 2021</td></tr><tr><th><i>H. transiens</i></th><td>NH 12304 (GB)</td><td>DQ677504</td><td>DQ677504</td><td>Larsson 2007</td></tr><tr><th><i>H. tropicum</i></th><td>CLZhao 17308</td><td>OM985727</td><td>OM985768</td><td>Duan <i>et al</i>. 2023</td></tr><tr><th><i>H. variolosum</i></th><td>CBS: 734.91</td><td>MH862320</td><td>MH873992</td><td>Vu <i>et al.</i> 2019</td></tr><tr><th><i>H. variolosum</i></th><td>CBS: 735.91</td><td>MH862321</td><td>MH873993</td><td>Vu <i>et al.</i> 2019</td></tr><tr><th><i>H. weishanense</i></th><td>CLZhao 22403</td><td>OR141727</td><td>OR506181</td><td>Yang <i>et al</i>. 2023</td></tr></tbody></table><p>...continued on the next page</p>

opennotspecifiedJul 2024View details →
zenodo32/100

TABLE 1 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae

<p><b>TABLE 1.</b> Primers used to amplify loci used for assessment of <i>Shellenius serratus</i> <b>sp. nov.</b> and corresponding annealing temperatures and extension times.</p><table><tbody><tr><th>Primer Name</th><th>Gene</th><th>Sequence (5&rsquo;&rarr;3&rsquo;)</th><th>Annealing</th><th>Extension</th><th>Reference</th></tr></tbody><tbody><tr><th>LCO1490 HCO2198</th><td>COI</td><td>GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA</td><td>40&ring;C</td><td>1 min. 30 sec.</td><td>Folmer <i>et al.</i> 1994</td></tr><tr><th>18SACDN_F1 18SACDN_R1</th><td>18S</td><td>AGAGGGAGCCTGAGAAACG GGGCAGGGACGTAATCAAC</td><td>60&ring;C</td><td>1 min. 45 sec.</td><td>Bahder <i>et al.</i> 2023</td></tr><tr><th>V/Forward X/Reverse</th><td>28S</td><td>GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC</td><td>55&deg;C</td><td>1 min. 30 sec.</td><td>Cryan <i>et al.</i> 2000</td></tr></tbody></table>

opennotspecifiedSep 2024View details →
zenodo32/100

FIGURE 6. A in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 6. A: Map showing geographic distribution of the subclade 2. B–D: Types of vegetation and environments of occurrence, B: "cerrado rupestre" (Chapada dos Veadeiros National Park, GO). C: "cerrado típico" (Serra do Cabral State Park, MG). D: "cerrado ralo" (Chapada dos Veadeiros National Park, GO). E–G: Typical morphology of members of the subclade 2, E: Upright shrub up to 4 m tall (C. claussenii var. claussenii). F: Stem with waxy bark (C. claussenii var. claussenii). G: Flower showing the adaxial petal resembles one of the upper lateral petals (C. claussenii var. megacycla). States: DF = Federal District, GO = Goiás, MG = Minas Gerais, MS = Mato Grosso do Sul, MT = Mato Grosso, TO = Tocantins.

opennotspecifiedMay 2020View details →
zenodo32/100

FIGURE 8 in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 8. Diagnostic morphological characters of the species of the Paniculatae series: A: shrubby erect habit in Ch. claussenii. B: shrubby decumbent habit in Ch. ustulata. C: arboreal habit in Ch. orbiculata. D: longitudinally fissured bark in Ch. celiae. E: waxy bark in Ch. claussenii. F: alternate spiral leaves in Ch. claussenii. G: long and divaricate leaflets in Ch. claussenii. H: prominent veins on both sides and coriaceous in Ch. claussenii. I: inflorescence axes viscous in Ch. celiae. J: paniculate inflorescences in Ch. claussenii. K: racemous inflorescences in Ch. tocantinensis. L. asymmetric flowers with adaxial petal similar to a standard in Ch. orbiculata.

opennotspecifiedMay 2020View details →
zenodo32/100

FIGURE 7 in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 7. Distribution area of species of the Paniculatae series, where BA = Bahia, BO = Bolívia, GO = Goiás, MG = Minas Gerais, MS = Mato Grosso do Sul, MT = Mato Grosso, PI = Piauí and TO = Tocantins.

opennotspecifiedMay 2020View details →
zenodo32/100

FIGURE 4. A in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 4. A: Map showing geographic distribution of the subclade 1a. B-D: Types of vegetation and environments of occurrence, B: Transition between Cerrado and Caatinga (Grão Mogol State Park, MG). C: "cerrado típico" (Senador Modestino Gonçalves, MG). D: "cerrado típico" with rocky soil (Barrocão, MG). E-G: Typical morphology of members of the subclade 1a, E: Setulose paniculate inflorescence (Chamaecrista celiae). F: Leaf with two pairs of leaflets (C. orbiculata var. cercidifolia). G: Bud showing indumentum (C. orbiculata var. ustulata). States: MG = Minas Gerais.

opennotspecifiedMay 2020View details →
zenodo32/100

FIGURE 5. A in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 5. A: Map showing geographic distribution of the subclade 1b. B-D: Types of vegetation and environments of occurrence, B: "cerrado rupestre" (Chapada dos Veadeiros National Park, GO). C: "cerrado típico" (Chapada dos Veadeiros National Park, GO). D: Cerrado drainage (Chapada dos Veadeiros National Park, GO). E-G: Typical morphology of members of the subclade 1b, E: Arboreous habit (C. orbiculata var. orbiculata). F: Shrubby habit (C. pachyclada). G: Leaf with more than two pairs of leaflets (C. orbiculata var. orbiculata). States: DF = Federal District, GO = Goiás.

opennotspecifiedMay 2020View details →
zenodo32/100

FIGURE 3. A in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 3. A: Map showing geographic distribution of the subclade 1. B-D: Types of vegetation and environments of occurrence, B: "cerrado rupestre" (Chapada dos Veadeiros National Park, GO). C: Transition between Cerrado and Caatinga (Grão Mogol State Park, MG). D: "cerrado típico" (Serra Dourada State Park, GO). E-G: Typical morphology of member of the subclade 1 (Chamaecrista orbiculata), E: Habit. F: Detail of the stem with fissured bark, G: Paniculate inflorescence. States: BA = Bahia; DF = Federal District; GO = Goiás; MG = Minas Gerais; MS = Mato Grosso do Sul; MT = Mato Grosso; PI = Piauí; TO = Tocantins.

opennotspecifiedMay 2020View details →
zenodo32/100

FIGURE 2 in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group

FIGURE 2. Maximum clade credibility tree of the divergence time analysis (trnL-F + ITS) in BEAST. X-axis time scale in millions of years (My). Number in the nodes correspond to the mean age and blue bars correspond to 95% HPD (height posterior density). Clade highlighted in yellow correspond to clade Paniculatae. Subclades 1 and 2 and lineages 1a and 1b are discussed in the text.

opennotspecifiedMay 2020View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record