Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
2,620
datasets available to search
ShareScore release 0.9.0
Dataset results
2,620 results for “Molecular phylogenies”
FIGURE 1 in Molecular phylogeny and diversification timing of the Chamaecrista sect. Absus subsect. Absus ser. Paniculatae, a newly circumscribed and predominantly endemic of the Cerrado Biome group
FIGURE 1. Majority rule consensus tree from Bayesian Inference (BI) of the combined dataset (ITS + trnL-F). Numbers above the branches indicate posterior probability (decimals) and below indicate bootstrap/jackknife support (percentage) for the clades recovered in BI and maximum parsimony, respectively. The infracategories shown to the right of the names of the species follow the classification of Irwin & Barneby (1982). The taxa outlined in yellow correspond to series Paniculatae. Sect. = Section; Subsect. = Subsection; Ser. = Series.
Table 1 in Molecular phylogeny and comparative morphology reveal the species validity and systematic position of Lepidodesma (Bivalvia: Unionidae)
<p><b>Table 1</b> Historical classification systems of the genus <i>Lepidodesma</i> in Unionidae</p><table><tbody><tr><th>Author</th><th>Subfamily</th><th>Tribe</th></tr></tbody><tbody><tr><th>Heude (1874)</th><td>Unioninae</td><td>–</td></tr><tr><th>Simpson (1896)</th><td>Unioninae</td><td>–</td></tr><tr><th>Hass (1969)</th><td>Anodontinae</td><td>–</td></tr><tr><th>Liu (1979)</th><td>Anodontinae</td><td>–</td></tr><tr><th>Prozorova et al. (2005)</th><td>Anodontinae</td><td>–</td></tr><tr><th>Huang et al. (2002)</th><td>Unioninae</td><td>–</td></tr><tr><th>Graf and Cummings (2007)</th><td>Unioninae</td><td>Unionini</td></tr><tr><th>Zhou et al. (2016)</th><td>Unioninae</td><td>–</td></tr><tr><th>Huang et al. (2019)</th><td>Unioninae</td><td>Lepidodesmini</td></tr><tr><th>Lopes-Lima et al. (2020)</th><td>Unioninae</td><td>Lepidodesmini</td></tr><tr><th>Graf and Cummings (2021)</th><td>Unioninae</td><td>Unionini</td></tr><tr><th><b>In this study</b></th><td>Unioninae</td><td>Lepidodesmini</td></tr></tbody></table>
Table 3 in Molecular phylogeny and comparative morphology reveal the species validity and systematic position of Lepidodesma (Bivalvia: Unionidae)
<p><b>Table 3</b> Three-gene sequences used for species evolutionary analysis and corresponding GenBank numbers</p><table><tbody><tr><th><b>Taxa</b></th><th><b>COI</b></th><th><b>16S rRNA</b></th><th><b>28S rRNA</b></th></tr><tr><th>Unionidae Rafinesque, 1820</th></tr><tr><th>Unioninae Rafinesque, 1820</th></tr><tr><th>Anodontini Rafinesque, 1820</th></tr></tbody><tbody><tr><th><i>Pyganodon grandis</i> (Say, 1829)</th><td>AF231734</td><td>NC_013661</td><td>AF305384</td></tr><tr><th><i>Strophitus undulatus</i> (Say, 1817)</th><td>AF156505</td><td>AY238491</td><td>DQ191415</td></tr><tr><th><i>Platynaias compressa</i> (Lea, 1829)</th><td>AF156503</td><td>NC_015481</td><td>DQ191414</td></tr><tr><th><i>Anodonta anatina</i> (Linnaeus, 1758)</th><td>KX822632</td><td>NC_022803</td><td>KX822588</td></tr><tr><th><i>Anodonta cygnea</i> (Linnaeus, 1758)</th><td>KX822633</td><td>JQ253863</td><td>KX822589</td></tr><tr><th><i>Pseudanodonta complanata</i> (Rossmässler, 1835)</th><td>KX822661</td><td>JQ253868</td><td>KX822617</td></tr><tr><th>Cristariini Lopes-Lima, Bogan & Froufe, 2017 in Lopes-Lima et al., 2017a</th></tr><tr><th><i>Sinanodonta woodiana</i> (Lea, 1834)</th><td>HQ283346</td><td>HQ283346</td><td>MG595604</td></tr><tr><th><i>Sinanodonta tumens</i> (Haas, 1910)</th><td>LC519024</td><td>LC224015</td><td>LC519081</td></tr><tr><th><i>Cristaria plicata</i> (Leach, 1814)</th><td>NC_012716</td><td>NC_012716</td><td>MG595484</td></tr><tr><th><i>Anemina arcaeformis</i> (Heude, 1877)</th><td>NC_026674</td><td>NC_026674</td><td>MG595457</td></tr><tr><th>Lepidodesmini Huang et Wu, 2019 in Huang et al., 2019</th></tr><tr><th><i>Lepidodesma languilati</i> (Heude, 1874) SU 106</th><td>MG463016</td><td>AF389411</td><td>MG595543</td></tr><tr><th><i>Lepidodesma languilati</i> (Heude, 1874) SU 107</th><td>MG463015</td><td>AF389411</td><td>MG595544</td></tr><tr><th><i>Lepidodesma languilati</i> (Heude, 1874) SU 108</th><td>MG463017</td><td>AF389411</td><td>MG595545</td></tr><tr><th><i>Lepidodesma languilati</i> (Heude, 1874) 1 a</th><td>OQ880586</td><td>OQ881064</td><td>OQ881058</td></tr><tr><th><i>Lepidodesma languilati</i> (Heude, 1874) 2 a</th><td>OQ880587</td><td>OQ881065</td><td>OQ881059</td></tr><tr><th><i>Lepidodesma languilati</i> (Heude, 1874) 3 a</th><td>OQ880588</td><td>OQ881066</td><td>OQ881060</td></tr><tr><th><i>Lepidodesma aligera</i> (Heude, 1877) 1 a</th><td>OQ908914</td><td>OQ892281</td><td>OQ892278</td></tr><tr><th><i>Lepidodesma aligera</i> (Heude, 1877) 2 a</th><td>OQ908915</td><td>OQ892282</td><td>OQ892279</td></tr><tr><th>Ambleminae Rafinesque, 1820</th></tr><tr><th>Lampsilini Ihering, 1901</th></tr><tr><th><i>Potamilus alatus</i> (Say, 1817)</th><td>KP795037</td><td>KU559011</td><td>KP795019</td></tr><tr><th><i>Lampsilis cardium</i> Rafinesque, 1820</th><td>AF120653</td><td>KX713226</td><td>AF305386</td></tr><tr><th><i>Obliquaria reflexa</i> Rafinesque, 1820</th><td>GU085300</td><td>AY655055</td><td>AF400689</td></tr><tr><th><i>Truncilla truncata</i> Rafinesque, 1820</th><td>AF156513</td><td>AY655080</td><td>DQ191419</td></tr><tr><th>Pleurobemini Hannibal, 1912</th></tr><tr><th><i>Elliptio complanata</i> (Lightfoot, 1786)</th><td>EU448173</td><td>DQ094144</td><td>JF899181</td></tr><tr><th>Quadrulini Ihering, 1901</th></tr><tr><th><i>Quadrula quadrula</i> (Rafinesque, 1820)</th><td>AF156511</td><td>NC_013658</td><td>DQ191417</td></tr><tr><th>Margaritiferidae Henderson, 1929</th></tr><tr><th><i>Margaritifera margaritifera</i> (Linnaeus, 1758)</th><td>KX550089</td><td>KX550091</td><td>KX550093</td></tr><tr><th><i>Margaritifera dahurica</i> (Middendorff, 1850)</th><td>KJ161516</td><td>KJ943526</td><td>KT343747</td></tr></tbody></table><p><sup>aThe</sup> sequence from this study</p>
Fig. 3 in Molecular phylogeny and comparative morphology reveal the species validity and systematic position of Lepidodesma (Bivalvia: Unionidae)
Fig. 3 Schematic drawing for gene arrangement and structure characteristics of Lepidodesma aligera and Lepidodesma languilati. Protein-coding and tRNA genes are colored to show the difference and commonness of codon (and anti-codon) usage. Arabic numerals in the figure represent the length (bp) of the corresponding gene. Abbreviation of 22 tRNAs: H, tRNAHis; A, tRNAAla; S2, tRNASer2; S1,tRNA Ser1; E, tRNAGlu; M, tRNAMet; W, tRNATrp; R, tRNAArg; K,tRNA Lys; T, tRNAThr; Y, tRNATyr; L1, tRNALeu1; N, tRNAAsn; P,tRNA Pro; F, tRNAPhe; Q, tRNAGln; C, tRNACys; I, tRNAIle; V, tRNA Val; L2, tRNALeu2; G, tRNAGly; D, tRNAAsp
Table 2 in Molecular phylogeny, biogeography, and species delimitation of segmented spider genus Liphistius (Araneae: Liphistiidae) in Thailand
<p><b>Table 2.</b> Primers used and their annealing temperatures.</p><table><tbody><tr><th><b>Gene</b></th><th><b>Primer</b></th><th><b>Sequence (5</b> <i>ʹ</i> <b>–3</b> <i>ʹ</i><b>)</b></th><th><b>Annealing temperature (°C)</b></th><th><b>Reference</b></th></tr></tbody><tbody><tr><th><i>CO1</i></th><td>LCO1490</td><td>GGTCAACAAATCATAAAGATATTGG</td><td>40</td><td>Folmer <i>et al</i>. (1994)</td></tr><tr><th></th><td>HCO2198</td><td>TAAACTTCAGGGTGACCAAAAAATCA</td><td>40</td><td>Folmer <i>et al</i>. (1994)</td></tr><tr><th>16S</th><td>16Sar</td><td>ATAGAGCTCCCATGGCGCCTGTTTAT CAAAAACAT</td><td>54</td><td>Huber <i>et al</i>. (1993)</td></tr><tr><th></th><td>16Sbr</td><td>ATAGAGCTCCCATGGCCGGTCTGAA CTCAGATCACGT</td><td>54</td><td>Huber <i>et al</i>. (1993)</td></tr><tr><th>ITS2</th><td>ITS-5.8S</td><td>GGGACGATGAAGAACGCAGC</td><td>47</td><td>White <i>et al</i>. (1990)</td></tr><tr><th></th><td>ITS-28S</td><td>TCCTCCGCTTATTGATATGC</td><td>47</td><td>White <i>et al</i>. (1990)</td></tr><tr><th>28S</th><td>28S-O</td><td>GAAACTGCTCAAAGGTAAACGG</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th></th><td>28S-C</td><td>GGTTCGATTAGTCTTTCGCC</td><td>55</td><td>Hedin and Maddison (2001)</td></tr><tr><th><i>H3</i></th><td>H3aF</td><td>ATGGCTCGTACCAAGCAGACVGC</td><td>50</td><td>Colgan <i>et al</i>. (1998)</td></tr><tr><th></th><td>H3aR</td><td>ATATCCTTRGGCATRATRGTGAC</td><td>50</td><td>Colgan <i>et al</i>. (1998)</td></tr></tbody></table>
Table 2. Genetic distances for mitochondrial DNA partial cytochrome c oxidase subunit I and cytochrome b in Molecular phylogeny of the Aplodactylidae (Perciformes: Cirrhitoidea), a group of Southern Hemisphere marine ® shes
<p>Table 2. Genetic distances for mitochondrial DNA partial cytochrome <i>c</i> oxidase subunit I and cytochrome <i>b</i> sequences when combined. Values are Kimura (1980) two-parameter percentage sequence divergences, obtained when using the optimum expected transition±transversion nucleotide substitution ratio of 3.0 from maximum likelihood analysis (fi gure 3).</p><table><tbody><tr><th></th><th></th><th>1</th><th>2</th><th>3</th><th>4</th><th>5</th><th>6</th><th>7</th></tr></tbody><tbody><tr><th>1</th><td><i>Aplodactylus arctidens</i></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td></tr><tr><th>2</th><td><i>Aplodactylus punctatus</i></td><td>6.1</td><td></td><td></td><td></td><td></td><td></td><td></td></tr><tr><th>3</th><td><i>Aplodactylus westralis</i></td><td>7.8</td><td>7.6</td><td></td><td></td><td></td><td></td><td></td></tr><tr><th>4</th><td><i>Aplodactylus etheridgii</i></td><td>10.0</td><td>10.3</td><td>10.0</td><td></td><td></td><td></td><td></td></tr><tr><th>5</th><td><i>Aplodactylus lophodon</i></td><td>11.8</td><td>11.9</td><td>12.4</td><td>11.1</td><td></td><td></td><td></td></tr><tr><th>6</th><td><i>Chironemus marmoratus</i></td><td>20.0</td><td>18.7</td><td>18.3</td><td>19.3</td><td>19.5</td><td></td><td></td></tr><tr><th>7</th><td><i>Cheilodactylus fasciatus</i></td><td>21.8</td><td>21.0</td><td>20.5</td><td>22.6</td><td>20.2</td><td>21.2</td><td></td></tr><tr><th>8</th><td><i>Cirrhitus splendens</i></td><td>22.6</td><td>20.7</td><td>21.0</td><td>23.1</td><td>22.0</td><td>23.1</td><td>22.8</td></tr></tbody></table>
Data from: Phylogeny and circumscription of Cephalocereus (Cactaceae) based on molecular and morphological evidence
Cephalocereus, Neobuxbaumia, and Pseudomitrocereus (Cactaceae, Cactoideae, Echinocereeae) are related genera of columnar cacti native to Mexico with current ambiguous circumscription. We applied maximum parsimony and Bayesian inference methods to reconstruct the phylogeny of the Cephalocereus group using molecular data from seven chloroplast regions (petL-psbE, psbA-trnH, rpl16, rpl32-trnLUAG, trnL-F, trnQrps16, andycf1), simple coded indels, and 46 structural characters. The Cephalocereus group was recovered as monophyletic with high support values, whereas Neobuxbaumia appeared as paraphyletic, due to the polyphyly of Cephalocereus and the derived position of Pseudomitrocereus within this group. Topology was mostly congruent among the different phylogenetic methods explored, and three pervasive clades were observed. Two structural characters were confirmed as synapomorphies for the Cephalocereus group: prismatic crystals in the dermal system and a perianth woody cap persistent in the fruit. The derived position of Pseudomitrocereus suggests that new hypotheses must be explored regarding the possible hybrid origin of this taxon. We propose the transfer of all species of Neobuxbaumia, Cephalocereus, and Pseudomitrocereus to a single genus, in which Cephalocereus takes priority over the other names. Based on our results, a new circumscription for Cephalocereus is proposed, including a taxonomic synthesis, two new combinations (Cephalocereus multiareolatus and Cephalocereus sanchezmejoradae), and a key for species.
Figure 6 in Morphology, morphogenesis and molecular phylogeny of the new soil ciliate Sterkiella paratricirrata n. sp. (Ciliophora, Hypotrichia, Oxytrichidae)
Figure 6. Maximum likelihood (ML) tree inferred from the SSU rDNA sequences showing the systematic position of Sterkiella paratricirrata n. sp. (in red). The sequences of other Sterkiella species are indicated in bold. Numbers near nodes are bootstrap values for maximum-likelihood and posterior probability values for Bayesian inference (BI). '-' at nodes indicate disagreement between the two methods. The scale bar corresponds to 0.01 expected substitutions per site.
Figure 5 in Morphology, morphogenesis and molecular phylogeny of the new soil ciliate Sterkiella paratricirrata n. sp. (Ciliophora, Hypotrichia, Oxytrichidae)
Figure 5. Photomicrographs of Sterkiella paratricirrata n. sp. in morphogenesis after protargol impregnation. (a, b) Ventral views of early dividers, to show the oral primordium in each divider (arrowheads). (c) Ventral view of an early divider, the arrowhead points to the disaggregating buccal cirrus, and the arrow shows cirrus V/4 dedifferentiates. (d) Arrowheads mark the frontoventraltransverse anlagen. Note that anlagen V and VI formed de novo in proter. (e) The arrow marks cirri III/2 and IV/3 disaggregate to involve in the formation of primordial streaks. (f) Arrowheads indicate the right marginal anlagen originate earlier than the left ones. (g, h) Ventral (g) and dorsal (h) view of a same divider, showing the anlagen for the left and right marginal cirral rows (arrowheads in g), parental undulating membranes dedifferentiate to form the undulating membranes anlage (arrow in g), cirrus V/3 is not involved in primordia formation (circle in g), and dorsal kineties anlagen develop intrakinetally (arrowheads in h). (i–k) Ventral (i, k) and dorsal (j) views of middle dividers, showing the frontoventral-transverse anlagen fragmentise to cirri. Arrowheads in (i) mark the leftmost frontal cirrus separated from the undulating membranes anlage, the arrows in (i) point the newly formed dorsomarginal kinety anlage, and arrows in (j) show the third dorsal kinety anlage splitting to form dorsal kineties 3 and 4. Note the macronuclear nodules fusing into a single mass. (l–o) Ventral (l, n) and dorsal (m, o) views of late dividers (n and o show the proter of a same divider). Note that the new ciliary structures move towards their final positions, arrowheads in (m) indicate the caudal cirri. 1–6, dorsal kineties 1–6. Scale bars = 50 µm.
Figure 4 in Morphology, morphogenesis and molecular phylogeny of the new soil ciliate Sterkiella paratricirrata n. sp. (Ciliophora, Hypotrichia, Oxytrichidae)
Figure 4. Middle and late stages of morphogenesis of Sterkiella paratricirrata n. sp. after protargol staining. (a–d) Ventral (a, c) and dorsal (b, d) views of two middle dividers, showing frontoventraltransverse anlagen differentiate into cirri and the leftmost frontal cirrus is separated from the undulating membranes anlage. Arrowheads in (a) mark the anlagen for dorsomarginal kineties. Arrowheads in (d) show the third dorsal kinety anlage splits to form dorsal kineties 3 and 4. Note the macronuclear nodules fusing into a single mass. (e–h) Ventral (e, g) and dorsal (f, h) views of two late dividers to show 16 frontoventral-transverse cirri migrating towards their final positions. Dotted lines connect cirri that develop from the same cirral streak. Note caudal cirri formed, and macronuclear nodules divide. LMA, left marginal anlagen; LMR, left marginal row; RMA, right marginal anlagen; RMR, right marginal row. Scale bars = 50 µm.
Figure 2 in Morphology, morphogenesis and molecular phylogeny of the new soil ciliate Sterkiella paratricirrata n. sp. (Ciliophora, Hypotrichia, Oxytrichidae)
Figure 2. Photomicrographs of Sterkiella paratricirrata n. sp. from life (a–h) and after staining with protargol (i–l). (a–d) Ventral views, showing the different body shapes, arrow in (a) marks the contractile vacuole. (e) Ventral view of the posterior portion of a cell, showing transverse cirri. (f) Showing nuclear apparatus. (g, h) Resting cyst, showing the cyst wall (opposed arrowheads in g). Squeezed cyst (h) with cytoplasm released, showing the polygon wrinkles on the surface. (i) Ventral view of the buccal field. (j) Dorsal view shows three caudal cirri (arrow). (k, l) Ventral (k) and dorsal (l) view of the holotype specimen, showing the general cirral pattern, arrowheads in (k) mark the dorsal kineties. Ma, macronuclear nodules; P, paroral; PTVC, pretransverse ventral cirri; PVC, postoral ventral cirri. Scale bars = 15 µm (g, h) and 50 µm (a–d, k, l).
Figure 1 in Morphology, morphogenesis and molecular phylogeny of the new soil ciliate Sterkiella paratricirrata n. sp. (Ciliophora, Hypotrichia, Oxytrichidae)
Figure 1. Morphology of Sterkiella paratricirrata n. sp. from life (a, b) and after protargol staining (c, d). (a) Ventral view of a representative individual. (b) Resting cyst. (c, d) Ventral (c) and dorsal (d) view of the holotype specimen, showing the infraciliature and nuclear apparatus. AZM, adoral zone of membranelles; CC, caudal cirri; CV, contractile vacuole; LMR, left marginal row; Ma, macronuclear nodules; Mi, micronuclei; RMR, right marginal row; I/1, II/3, III/3, frontal cirri; II/2, buccal cirrus; III/2, IV/ 3, VI/3, VI/4, frontoventral cirri; IV/2, V/4, V/3, postoral ventral cirri; V/2, VI/2, pretransverse ventral cirri; IV/1, V/1, VI/1, transverse cirri; 1–6, dorsal kineties 1–6. Scale bars = 10 µm (b) and 50 µm (a, c, d).
Figure 3 in Morphology, morphogenesis and molecular phylogeny of the new soil ciliate Sterkiella paratricirrata n. sp. (Ciliophora, Hypotrichia, Oxytrichidae)
Figure 3. Early stages of morphogenesis of Sterkiella paratricirrata n. sp. after protargol staining. (a, b) Ventral view of very early dividers to show oral primordium in each opisthe (arrowheads), note that the cirrus V/4 dedifferentiates to form anlagen V and VI (arrow in b), and the buccal cirrus begins to be disorganised. (c) Ventral view of an early divider, the arrowhead shows cirri III/3 and IV/3 are involved to form anlagen III and IV, while anlagen V and VI develop de novo in proter. (d, e) Ventral (d) and dorsal (e) view of an early divider, showing the cirri II/2, III/2 and IV/3 are involved in the formation of six primordial streaks (arrowheads in d), and the dorsal kineties anlagen start to develop intrakinetally within dorsal kineties 1–3 in both proter and opisthe (arrowheads in e). (f–h) Ventral (f, g) and dorsal (h) views of early dividers, showing five cirral streaks formed (arrows in f, g), the right marginal anlagen originate, and the dorsal kineties anlagen elongate (arrowheads in h). (i) Ventral view to show the marginal anlagen develop intrakinetally. LMA, left marginal anlagen; RMA, right marginal anlagen. Scale bars = 50 µm.
Data from: Phylogeny of the Stachys coccinea (Lamiaceae) complex based on molecular and morphological data
One of the largest genera within the Lamiaceae, Stachys, is in extreme need of taxonomic revision due to its demonstrated phylogenetic polyphyly. Among the New World Stachys, a group of seven species belonging to the Stachys coccinea complex is widely distributed in Mexico, where four of the species in this complex are considered endemic. The members of this complex are characterized by having large and red, orange, or purple corollas. The observed morphological variation, however, may insufficiently circumscribe this number of species, and an assessment combining the use of morphological and molecular data is needed. Here, we evaluated the circumscription of the Stachys coccinea complex and relationships among its members using phylogenetic analyses of chloroplast (cp) DNA sequence data and numerical analysis applied to morphological data. We found that morphological variation in this complex insufficiently circumscribed members of the complex, possibly caused by plasticity of diagnostic morphological characters. In addition, the utilized cpDNA regions, which are commonly used in plant phylogenetic reconstruction (trnL intron, trnL-F spacer, and rps16 intron sequences), render relationships among most of the species in the complex unresolved. We propose that the Stachys coccinea complex be recircumscribed, reducing the number of members to three species: Stachys coccinea, S. lindenii, and S. albotomentosa, keeping the original circumscription of these species and including S. pacifica, S. manantlanensis, S. torresii, and S. jaimehintonii as varieties of S. coccinea.
Data from: Molecular phylogeny, revised higher classification, and implications for conservation of endangered Hawaiian leaf-mining moths (Lepidoptera: Gracillariidae: Philodoria)
The leaf-mining moth genus Philodoria Walsingham (Lepidoptera: Gracillariidae) is composed of 30 described species, all of which are endemic to the Hawaiian Islands. Philodoria is known to feed on 10 families of endemic Hawaiian host plants, with several species recorded only from threatened or endangered hosts. Beyond their dependence on these plants, little is known of their evolutionary history and conservation status. We constructed a molecular phylogeny of Philodoria to assess validity of its current subgeneric classification and to help guide future work on this threatened Hawaiian lineage. Mitochondrial and nuclear DNA sequences from three genes (CO1, CAD, EF-1α) combining for a total of 2,041 base pairs, were collected from 11 Philodoria species, incorporating taxa from both currently recognized subgenera. These data were analyzed using both parsimony and model-based phylogenetic approaches. Contrary to the most recent systematic treatment of Philodoria, our results indicate strongly that the two currently recognized Philodoria subgenera are not monophyletic and that morphological characters used to classify them are homoplasious. Based on our robust results, we revised the higher classification of Philodoria: the subgenus Eophilodoria Zimmerman, 1978 is established as subjective junior synonym of Philodoria Walsingham, 1907. We also present new host plant and distribution data and discuss host range of Philodoria as it pertains to endangered Hawaiian plants.
Data from: Time-calibrated molecular phylogeny of pteropods
Pteropods are a widespread group of holoplanktonic gastropod molluscs and are uniquely suitable for study of long-term evolutionary processes in the open ocean because they are the only living metazoan plankton with a good fossil record. Pteropods have been proposed as bioindicators to monitor the impacts of ocean acidification and in consequence have attracted considerable research interest, however, a robust evolutionary framework for the group is still lacking. Here we reconstruct their phylogenetic relationships and examine the evolutionary history of pteropods based on combined analyses of Cytochrome Oxidase I, 28S, and 18S ribosomal rRNA sequences and a molecular clock calibrated using fossils and the estimated timing of the formation of the Isthmus of Panama. Euthecosomes with uncoiled shells were monophyletic with Creseis as the earliest diverging lineage, estimated at 41–38 million years ago (mya). The coiled euthecosomes (Limacina, Heliconoides, Thielea) were not monophyletic contrary to the accepted morphology-based taxonomy; however, due to their high rate heterogeneity no firm conclusions can be drawn. We found strong support for monophyly of most euthecosome genera, but Clio appeared as a polyphyletic group, and Diacavolinia grouped within Cavolinia, making the latter genus paraphyletic. The highest evolutionary rates were observed in Heliconoides inflatus and Limacina bulimoides for both 28S and 18S partitions. Using a fossil-calibrated phylogeny that sets the first occurrence of coiled euthecosomes at 79–66 mya, we estimate that uncoiled euthecosomes evolved 51–42 mya and that most extant uncoiled genera originated 40–15 mya. These findings are congruent with a molecular clock analysis using the Isthmus of Panama formation as an independent calibration. Although not all phylogenetic relationships could be resolved based on three molecular markers, this study provides a useful resource to study pteropod diversity and provides general insight into the processes that generate and maintain their diversity in the open ocean.
Data from: Molecular phylogeny of the cyprinid tribe Labeonini (Teleostei: Cypriniformes)
The cyprinid tribe Labeonini (sensu Rainboth, 1991) is a large group of freshwater fishes containing around 40 genera and 400 species. They are characterized by an amazing diversity of modifications to their lips and associated structures. In this study, a total of 34 genera and 142 species of putative members of this tribe, which represent most of the generic diversity and more than one third of the species diversity of the group, were sampled and sequenced for four nuclear genes and five mitochondrial genes (totalling 9,465 bp). Phylogenetic relationships and subdivision of this tribe were investigated and the placement and status of most genera are discussed. Partitioned maximum likelihood analyses were performed based on the nuclear dataset, mitochondrial dataset, combined dataset, and the dataset for each nuclear gene. Inclusion of the genera Paracrossochilus, Barbichthys, Thynnichthys, and Linichthys in the Labeonini was either confirmed or proposed for the first time. None of the genera Labeo, Garra, Bangana, Cirrhinus, and Crossocheilus are monophyletic. Taxonomic revisions of some genera were made: the generic names Gymnostomus Heckel, 1843, Ageneiogarra Garman, 1912 and Gonorhynchus McClelland, 1839 were revalidated; Akrokolioplax Zhang and Kottelat, 2006 becomes a junior synonym of Gonorhynchus; the species Osteochilus nashii was found to be a member of the barbin genus Osteochilichthys. Five historical hypotheses on the classification of the Labeonini were tested and rejected. We proposed to subdivide the tribe, which is strongly supported as monophyletic, into four subtribes: Labeoina, Garraina, Osteochilina, and Semilabeoina. The taxa included in each subtribe were listed and those taxa that need taxonomic revision were discussed.
FIGURE 9 in Integrative taxonomy base on morphology and molecular phylogeny with description of a new genus, Progoniogryllus gen. nov. and two new species (Orthoptera: Grylloidea: Gryllidae; Gryllinae)
FIGURE 9. Heads of Progoniogryllus. A–B. P. directus sp. nov. A. female; B. male; C–D. P. rotundus sp. nov. C. female; D. male.
FIGURE 4 in Integrative taxonomy base on morphology and molecular phylogeny with description of a new genus, Progoniogryllus gen. nov. and two new species (Orthoptera: Grylloidea: Gryllidae; Gryllinae)
FIGURE 4. Ovipositor of Progoniogryllus species. A, B. Inside of ovipositor apex in lateral view; C. D. Outside of ovipositor apex in lateral view; A, C. P. directus sp. nov.; B, D. P. rotundus sp. nov.
FIGURE 1 in Integrative taxonomy base on morphology and molecular phylogeny with description of a new genus, Progoniogryllus gen. nov. and two new species (Orthoptera: Grylloidea: Gryllidae; Gryllinae)
FIGURE 1. Living species of Progoniogryllus. A–D. P. rotundus sp. nov. A. male habitus; B. spermatophore of male; C. female habitus; D. a female eating spermatophore. E–F. P. directus sp. nov. E. male habitus; F. female habitus.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.