Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
2,399
datasets available to search
ShareScore release 0.9.0
Dataset results
2,399 results for “fragmenter”
Figure 3 from: Bichuette ME, Trajano E (2018) Diversity of Potamolithus (Littorinimorpha, Truncatelloidea) in a high-diversity spot for troglobites in southeastern Brazil: role of habitat fragmentation in the origin of subterranean fauna, and conservation status. Subterranean Biology 25: 61-88. https://doi.org/10.3897/subtbiol.25.23778
Figure 3 Schematic intestine forms observed in Potamolithus species from Alto Ribeira karst area, Southeastern Brazil. Abapertural view.
Figure 1 from: Bichuette ME, Trajano E (2018) Diversity of Potamolithus (Littorinimorpha, Truncatelloidea) in a high-diversity spot for troglobites in southeastern Brazil: role of habitat fragmentation in the origin of subterranean fauna, and conservation status. Subterranean Biology 25: 61-88. https://doi.org/10.3897/subtbiol.25.23778
Figure 1 Map showing the surveyed localities (basins, microbasins and caves) from Alto Ribeira karst area, Southeastern Brazil. Some localities are approximated (*) (Author: DM von Schimonsky). Caves: A1 – Aranhas, A2 – Chapéu Mirim I, A3 – Chapéu, A4 – Chapéu Mirim II, A5 – Temimina II, A6 – Gurutuva, A7 – Córrego Seco, A8 – Fendão, A9 – Paiva, A10 – Jane Mansfield, A11 – Minotauro; B1 – Areias de Cima, B2 – Areias de Baixo, B3 – Ressurgência das Areias de Água Quente; C – Ouro Grosso; D – Alambari de Baixo; E – Água Suja; F1 – Pérolas, F2 – Santana; G1 – Casa de Pedra, G2 – Água Sumida; H – Tapagem; I1 – Morro Preto, I2 – Couto; J – Pescaria; K* – Betari de Baixo; L – Jeremias; M – Colorida; N – Calcário Branco; O – Alambari de Cima. Epigean streams: a – Ouro Grosso; b – Alambari; c – Água Suja; d – Roncador; e – Maximiano; f – Ostras; g – Calcário Branco; h – Iporanga; i1 – Betari, i2 – Água Quente, i3 – Morro Preto; j1 – Bocaina, j2 – Espírito Santo, j3 – Temimina, j4 – Pescaria, j5 – Lageado, j6 – Pilões, j7 – Ribeira, j8 – Cutia de Cima.
Figure 7 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 7 Scheme with overview of PCR attempts to recover the barcoding region of cytochrome c oxidase subunit I with novel primers from archival specimens from the genera Aphidius, Praon, Lysiphlebus, Ephedrus and Monoctonus. Primer pairs coloured red were used in direct PCR; black coloured primers were used in secondary nested reactions. Positions where short fragments within the subsequences overlap are marked with a pattern.
Figure 3 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 3 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Praon samples. Three direct PCR reactions were conducted with primer pairs: 1. LCO1490/Pr1Rd, 2. Pr2Fd/Pr2Rd, 3. Pr3Fd/HCO2198. The species included in trials are PF1- P. volucre, PF2- P. dorsale, PF3- P. abjectum; M – marker.
Figure 6 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 6 Agarose gel visualizing the products of nested trials with products of direct PCR for samples LD8 – L. confusus, LD9 – L. desertorum; LD12 – L. fabarum; and LD13 – L. alpinus. The products of LD8 and LD9 from PCR with LCO1490/Lys1Rd were submitted to secondary reactions combining two primer pairs, viz., 1. LCO1490/Lys1Rn; and 2. Lys1Fn/Lys1Rd. Amplicons of LD8, LD9 and LD12 obtained with Aph2Fd/Lys2Rd were submitted to secondary nested trials with primer pairs Aph2Fd/Lys2Rn and Lys2Fn/Lys2Rd. Products from direct PCR with Lys3Fd/HCO2198 were used as the template for nested reactions with Lys3Fd/Aph3Rn and Lys3Fn/HCO2198.
Figure 5 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 5 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Lysiphlebus samples. Tested combinations of primers were: 1) LCO1490/Lys1Rd; 2) Aph2Fd/Lys2Rd; 3) Pr2Fd/Lys2Rd; and 4) Lys3Fd/HCO2198. The species included in trials were: LF1 - L. hirticornis; LF2 - L. cardui; and LF3 - L. fabarum; M – marker.
Figure 4 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 4 Agarose gel visualizing the products of nested trials with products of direct PCR for samples PD12 - P. barbatum, PD14 - P. yomenae, and PD15 - P. yomenae. The products from PCR with Pr2Fd/Pr2Rd were submitted to secondary nested trials with primer pairs Pr2Fd/Pr2Rn and Aph2Fn/Pr2Rd. Amplicons obtained with Pr3Fd/HCO2198 were used as the template for nested reactions with Pr3Fd/Pr3Rn and Pr3Fn/HCO2198.
Figure 1 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 1 Position of internal degenerative primers within the barcoding region of COI. Aphidius - specific primers: Aph1Fn, Aph1Rn, Aph1Rd, Aph2Fd, Aph2Fn, Aph2Rn, Aph2Rd, Aph3Fd, Aph3Fn and Aph3Rn; Lysiphlebus - specific primers: Lys1Fn, Lys1Rd, Lys2Fn, Lys2Rn, Lys2Rd, Lys3Fd and Lys3Fn; Praon - specific primers: Pr1Fn, Pr1Rn, Pr1Rd, Pr2Fd, Pr2Rn, Pr2Rd, Pr3Fd, Pr3Fn and Pr3Rn. Arrows refer to the direction of the primers, forward or reverse. The exact position of internal primers is designated in comparison to the first nucleotide of the forward LCO1490 primer sequence (5' GGTCAACAAATCATAAAGATATTGG 3').
Figure 2 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 2 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Aphidius samples. Three direct PCR reactions were conducted with the following primer pairs: 1 LCO1490/Aph1Rd 2 Aph2Fd/Aph2Rd; and 3 Aph3Fd/HCO2198. The species included in trials were: AF1- A. tanacetarius, AF2- A. sussi, AF3- A. sonchi, AF4- A. linosiphonis and AF5- A. ribis. M – marker.
Figure 8 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 8 The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model. The tree with the highest log likelihood is shown. There were a total of 568 positions in the final dataset. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The percentage of replicate trees >50% in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches.
Figure 4 from: Sánchez-Reyes UJ, Niño-Maldonado S, Clark SM, Barrientos-Lozano L, Almaguer-Sierra P (2019) Successional and seasonal changes of leaf beetles and their indicator value in a fragmented low thorn forest of northeastern Mexico (Coleoptera, Chrysomelidae). ZooKeys 825: 71-103. https://doi.org/10.3897/zookeys.825.30455
Figure 4 - Cluster analysis of leaf beetle composition between succession and seasonal categories (rainy and dry) in a low thorn forest in northeastern Mexico. The dotted line indicates the delimitation of the groups.
Figure 1 from: Sánchez-Reyes UJ, Niño-Maldonado S, Clark SM, Barrientos-Lozano L, Almaguer-Sierra P (2019) Successional and seasonal changes of leaf beetles and their indicator value in a fragmented low thorn forest of northeastern Mexico (Coleoptera, Chrysomelidae). ZooKeys 825: 71-103. https://doi.org/10.3897/zookeys.825.30455
Figure 1 - Location of the low thorn forest fragment in northeastern Mexico. A Tamaulipas, Mexico B location of the fragment within the State C detailed location of the LTF fragment in the foothills of the Sierra Madre Oriental, north of the Natural Protected Area Altas Cumbres.
Figure 6 from: Sánchez-Reyes UJ, Niño-Maldonado S, Clark SM, Barrientos-Lozano L, Almaguer-Sierra P (2019) Successional and seasonal changes of leaf beetles and their indicator value in a fragmented low thorn forest of northeastern Mexico (Coleoptera, Chrysomelidae). ZooKeys 825: 71-103. https://doi.org/10.3897/zookeys.825.30455
Figure 6 - Chrysomelidae species with significant indicator value of successional time in a low thorn forest fragment in northeastern Mexico. A Dysphenges sp. 1 B Epitrix sp. 1 C Epitrix sp. 2 D Epitrix sp. 3 E Epitrix sp. 4 F Helocassis clavata (Fabricius, 1798) G Heterispa vinula (Erichson, 1847) H Margaridisa sp. 1 I Parchicola sp. 1 J Parchicola sp. 2 K Plagiodera thymaloides Stål, 1860 L Sumitrosis inaequalis (Weber, 1801). Scale bar: 1 mm.
Figure 2 from: Sánchez-Reyes UJ, Niño-Maldonado S, Clark SM, Barrientos-Lozano L, Almaguer-Sierra P (2019) Successional and seasonal changes of leaf beetles and their indicator value in a fragmented low thorn forest of northeastern Mexico (Coleoptera, Chrysomelidae). ZooKeys 825: 71-103. https://doi.org/10.3897/zookeys.825.30455
Figure 2 - Successional gradient of low thorn forest in northeastern Mexico, and location of the sampling plots.
Figure 3 from: Sánchez-Reyes UJ, Niño-Maldonado S, Clark SM, Barrientos-Lozano L, Almaguer-Sierra P (2019) Successional and seasonal changes of leaf beetles and their indicator value in a fragmented low thorn forest of northeastern Mexico (Coleoptera, Chrysomelidae). ZooKeys 825: 71-103. https://doi.org/10.3897/zookeys.825.30455
Figure 3 - Seasonal variation of community parameters of Chrysomelidae in a successional gradient of low thorn forest in northeastern Mexico. Different letters between bars indicate significant differences.
Figure 7 from: Sánchez-Reyes UJ, Niño-Maldonado S, Clark SM, Barrientos-Lozano L, Almaguer-Sierra P (2019) Successional and seasonal changes of leaf beetles and their indicator value in a fragmented low thorn forest of northeastern Mexico (Coleoptera, Chrysomelidae). ZooKeys 825: 71-103. https://doi.org/10.3897/zookeys.825.30455
Figure 7 - Suggested species of Chrysomelidae for evaluating successional time and environmental monitoring of low thorn forest in northeastern Mexico. A Centralaphthona diversa (Baly, 1877) B Cyclotrypema furcata (Olivier, 1808) C Heterispa vinula (Erichson, 1847) D Acrocyum dorsalis Jacoby, 1885.
Figure 5 from: Sánchez-Reyes UJ, Niño-Maldonado S, Clark SM, Barrientos-Lozano L, Almaguer-Sierra P (2019) Successional and seasonal changes of leaf beetles and their indicator value in a fragmented low thorn forest of northeastern Mexico (Coleoptera, Chrysomelidae). ZooKeys 825: 71-103. https://doi.org/10.3897/zookeys.825.30455
Figure 5 - Chrysomelidae species with significant indicator value of successional time in a low thorn forest fragment in northeastern Mexico. A Acallepitrix sp. 1 B Epitrix sp. 5 C Acrocyum dorsalis Jacoby, 1885 D Alagoasa jacobiana (Horn, 1889) E Asphaera sp. 1 F Babia tetraspilota texana Schaeffer, 1933 G Brachycoryna pumila Guérin-Méneville, 1844 H Centralaphthona diversa (Baly, 1877) I Chaetocnema sp. 1 J Colaspis townsendi Bowditch, 1921 K Cryptocephalus trizonatus Suffrian, 1858 L Cyclotrypema furcata (Olivier, 1808). Scale bar: 1 mm.
Figure 11 in Soldier flies (Diptera: Stratiomyidae) on semideciduous seasonal forest fragments, with a list of species for São Paulo State, Brazil, and two new records of species for the country
Figure 11 Species accumulation curve and performance of the richness estimators of the Stratiomyidae collected at Reserva Ecológica e Biológica Augusto Ruschi, Sertãozinho, São Paulo, Brazil, from May 2010 to December 2011 and in September 2014.
Figure 10 in Soldier flies (Diptera: Stratiomyidae) on semideciduous seasonal forest fragments, with a list of species for São Paulo State, Brazil, and two new records of species for the country
Figure 10 Climate and seasonal data of soldier flies collected using white roof Malaise traps at the Reserva Ecológica e Biológica de Sertãozinho, São Paulo, Brazil.
Figure 7 in Soldier flies (Diptera: Stratiomyidae) on semideciduous seasonal forest fragments, with a list of species for São Paulo State, Brazil, and two new records of species for the country
Figure 7 Stratiomyids from the Reserva Ecológica e Biológica Augusto Ruschi, Sertãozinho, São Paulo, Brazil. (a) Chloromelas sp. 1, male; (b) Myxosargus sp. 1, male; (c) Myxosargus sp. 2, male; (d) Eidalimus sp. 1, male; (e) Manotes sp. 1, male; (f) Panacris lucida, male; (g) Popanomyia sp. 1, female; (h) Psephiocera sp. 1, female; (i) Strobilapsis sp. 1, female. Scale bar, 1 mm.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.