Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

227

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

227 results for “Aphidiinae”

Learn how ShareScore rates datasets ↗
zenodo28/100

FIGURE 5 in Parasitoids (Hymenoptera: Braconidae: Aphidiinae) attacking aphids feeding on Prunoideae and Maloideae crops in Southeast Europe: aphidiine-aphid-plant associations and key

FIGURE 5. Labial palpi of A. transcaspicus Telenga (female).

opennotspecifiedDec 2008View details →
zenodo28/100

FIGURE 1 in A new species of Acanthocaudus Smith (Braconidae: Aphidiinae), with a key to species and new host and distribution records for aphidiines associated with Silphium perfoliatum L. (Asterales: Asteraceae)

FIGURE 1. Lateral habitus, Acanthocaudus bicolor Kula, new species, based on type series.

opennotspecifiedDec 2017View details →
zenodo28/100

Figure 5 from: Kim S, Tomanović Ž, Yu Y, Sohn J, Han Y, Lee G, Kim H (2021) Three new species of the genus Aphidius (Hymenoptera, Braconidae, Aphidiinae) from South Korea. Journal of Hymenoptera Research 86: 63-77. https://doi.org/10.3897/jhr.86.70767

Figure 5 Aphidius areolatus Ashmead, female A body B wing C antennae D head E propodeum F dorsal view of petiole G lateral view of petiole.

opencc-by-4.0Oct 2021View details →
zenodo28/100

Figure 4 from: Kim S, Tomanović Ž, Yu Y, Sohn J, Han Y, Lee G, Kim H (2021) Three new species of the genus Aphidius (Hymenoptera, Braconidae, Aphidiinae) from South Korea. Journal of Hymenoptera Research 86: 63-77. https://doi.org/10.3897/jhr.86.70767

Figure 4 Aphidius asiaticus Kim & Tomanović, sp. nov., female A body B wing C antennae D head E propodeum F dorsal view of petiole G lateral view of petiole.

opencc-by-4.0Oct 2021View details →
zenodo28/100

Figure 2 from: Kim S, Tomanović Ž, Yu Y, Sohn J, Han Y, Lee G, Kim H (2021) Three new species of the genus Aphidius (Hymenoptera, Braconidae, Aphidiinae) from South Korea. Journal of Hymenoptera Research 86: 63-77. https://doi.org/10.3897/jhr.86.70767

Figure 2 Aphidius longicarpus Kim & Tomanović, sp. nov., female A body B wing C antennae D head E propodeum F dorsal view of petiole G lateral view of petiole.

opencc-by-4.0Oct 2021View details →
zenodo28/100

Figure 3 from: Kim S, Tomanović Ž, Yu Y, Sohn J, Han Y, Lee G, Kim H (2021) Three new species of the genus Aphidius (Hymenoptera, Braconidae, Aphidiinae) from South Korea. Journal of Hymenoptera Research 86: 63-77. https://doi.org/10.3897/jhr.86.70767

Figure 3 Aphidius longistigmus Kim & Tomanović, sp. nov., female A body B wing C antennae D head E propodeum F dorsal view of petiole G lateral view of petiole.

opencc-by-4.0Oct 2021View details →
zenodo28/100

Supplementary material 1 from: Kim S, Tomanović Ž, Yu Y, Sohn J, Han Y, Lee G, Kim H (2021) Three new species of the genus Aphidius (Hymenoptera, Braconidae, Aphidiinae) from South Korea. Journal of Hymenoptera Research 86: 63-77. https://doi.org/10.3897/jhr.86.70767

Table S1

opencc-zeroNov 2021View details →
zenodo28/100

Figure 1 from: Kim S, Tomanović Ž, Yu Y, Sohn J, Han Y, Lee G, Kim H (2021) Three new species of the genus Aphidius (Hymenoptera, Braconidae, Aphidiinae) from South Korea. Journal of Hymenoptera Research 86: 63-77. https://doi.org/10.3897/jhr.86.70767

Figure 1 Neighbour-joining tree of 28 Aphidius spp. from South Korea based on their COI DNA barcode. Diaeretiella rapae was used for an outgroup.

opencc-by-4.0Oct 2021View details →
zenodo28/100

Supplementary material 1 from: Kim S, Tomanović Ž, Petrović A, Čkrkić J, Lee G, Lim J, Kim H (2022) Toxares koreanus sp. nov. – a new Toxares species from South Korea (Hymenoptera, Braconidae, Aphidiinae). Journal of Hymenoptera Research 92: 185-198. https://doi.org/10.3897/jhr.92.84146

Figure S1

opencc-zeroSep 2022View details →
zenodo28/100

Figure 7 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 7 Scheme with overview of PCR attempts to recover the barcoding region of cytochrome c oxidase subunit I with novel primers from archival specimens from the genera Aphidius, Praon, Lysiphlebus, Ephedrus and Monoctonus. Primer pairs coloured red were used in direct PCR; black coloured primers were used in secondary nested reactions. Positions where short fragments within the subsequences overlap are marked with a pattern.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 3 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 3 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Praon samples. Three direct PCR reactions were conducted with primer pairs: 1. LCO1490/Pr1Rd, 2. Pr2Fd/Pr2Rd, 3. Pr3Fd/HCO2198. The species included in trials are PF1- P. volucre, PF2- P. dorsale, PF3- P. abjectum; M – marker.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 6 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 6 Agarose gel visualizing the products of nested trials with products of direct PCR for samples LD8 – L. confusus, LD9 – L. desertorum; LD12 – L. fabarum; and LD13 – L. alpinus. The products of LD8 and LD9 from PCR with LCO1490/Lys1Rd were submitted to secondary reactions combining two primer pairs, viz., 1. LCO1490/Lys1Rn; and 2. Lys1Fn/Lys1Rd. Amplicons of LD8, LD9 and LD12 obtained with Aph2Fd/Lys2Rd were submitted to secondary nested trials with primer pairs Aph2Fd/Lys2Rn and Lys2Fn/Lys2Rd. Products from direct PCR with Lys3Fd/HCO2198 were used as the template for nested reactions with Lys3Fd/Aph3Rn and Lys3Fn/HCO2198.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 5 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 5 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Lysiphlebus samples. Tested combinations of primers were: 1) LCO1490/Lys1Rd; 2) Aph2Fd/Lys2Rd; 3) Pr2Fd/Lys2Rd; and 4) Lys3Fd/HCO2198. The species included in trials were: LF1 - L. hirticornis; LF2 - L. cardui; and LF3 - L. fabarum; M – marker.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 4 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 4 Agarose gel visualizing the products of nested trials with products of direct PCR for samples PD12 - P. barbatum, PD14 - P. yomenae, and PD15 - P. yomenae. The products from PCR with Pr2Fd/Pr2Rd were submitted to secondary nested trials with primer pairs Pr2Fd/Pr2Rn and Aph2Fn/Pr2Rd. Amplicons obtained with Pr3Fd/HCO2198 were used as the template for nested reactions with Pr3Fd/Pr3Rn and Pr3Fn/HCO2198.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 1 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 1 Position of internal degenerative primers within the barcoding region of COI. Aphidius - specific primers: Aph1Fn, Aph1Rn, Aph1Rd, Aph2Fd, Aph2Fn, Aph2Rn, Aph2Rd, Aph3Fd, Aph3Fn and Aph3Rn; Lysiphlebus - specific primers: Lys1Fn, Lys1Rd, Lys2Fn, Lys2Rn, Lys2Rd, Lys3Fd and Lys3Fn; Praon - specific primers: Pr1Fn, Pr1Rn, Pr1Rd, Pr2Fd, Pr2Rn, Pr2Rd, Pr3Fd, Pr3Fn and Pr3Rn. Arrows refer to the direction of the primers, forward or reverse. The exact position of internal primers is designated in comparison to the first nucleotide of the forward LCO1490 primer sequence (5' GGTCAACAAATCATAAAGATATTGG 3').

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 2 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 2 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Aphidius samples. Three direct PCR reactions were conducted with the following primer pairs: 1 LCO1490/Aph1Rd 2 Aph2Fd/Aph2Rd; and 3 Aph3Fd/HCO2198. The species included in trials were: AF1- A. tanacetarius, AF2- A. sussi, AF3- A. sonchi, AF4- A. linosiphonis and AF5- A. ribis. M – marker.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 8 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 8 The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model. The tree with the highest log likelihood is shown. There were a total of 568 positions in the final dataset. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The percentage of replicate trees >50% in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 3 from: Tian H-W, van Achterberg C, Chen X-X (2018) The genera Areopraon Mackauer, 1959 and Pseudopraon Starý, 1975 (Hymenoptera, Braconidae, Aphidiinae) from China, with keys to species. ZooKeys 780: 61-70. https://doi.org/10.3897/zookeys.780.26264

Figure 3 Pseudopraonhei Tian & Chen, sp. n. A head, anterior aspect B head, dorsal aspect C mesonotum, dorsal aspect D propodeum, dorsal aspect ET1, dorsal aspect F habitus, lateral aspect G fore wing H antennae I hind wing J ovipositor & ovipositor sheath, lateral aspect K metasoma, lateral aspect L mesosoma, lateral aspect. Scale bars: 0.2 mm.

opencc-by-4.0Aug 2018View details →
zenodo28/100

Figure 2 from: Tian H-W, van Achterberg C, Chen X-X (2018) The genera Areopraon Mackauer, 1959 and Pseudopraon Starý, 1975 (Hymenoptera, Braconidae, Aphidiinae) from China, with keys to species. ZooKeys 780: 61-70. https://doi.org/10.3897/zookeys.780.26264

Figure 2 Areopraonchui Tian & Chen, sp. n. A fore wing B hind wing C mesosoma, lateral aspect D mesoscutum, dorsal aspect E metasoma, lateral aspect FT1, dorsal aspect G head, anterior aspect H head, dorsal view I antenna J propodeum, dorsal aspect K ovipositor sheaths, dorsal aspect.

opencc-by-4.0Aug 2018View details →
zenodo28/100

Figure 4 from: Mitrović M, Starý P, Jakovljević M, Petrović A, Žikić V, Pérez Hidalgo N, Tomanović Ž (2019) Integrative taxonomy of root aphid parasitoids from the genus Paralipsis (Hymenoptera, Braconidae, Aphidiinae) with description of new species. ZooKeys 831: 49-69. https://doi.org/10.3897/zookeys.831.31808

Figure 4 Phylogenetic relationship inferred using the maximum parsimony (MP) method. The consistency index is (0.533333), the retention index is (0.681818), and the composite index is 0.476540 (0.363636) for all sites and parsimony-informative sites. The MP tree was obtained using the subtree-pruning-regrafting (SPR) algorithm with search level 1, in which the initial trees were obtained by the random addition of sequences (10 replicates). The percentage of replicate trees in which >50% of the associated taxa clustered together in the bootstrap test (500 replicates) is shown next to the branches (in red color). Since the topology is identical, the bootstrap support of branches obtained by the maximum likelihood method is presented in black color as well. Barcoding haplotypes of the analyzed archival Paralipsis specimens are designated with codes from PH1 to PH14, species name, host aphid and host plant. Abbreviations for the countries of origin are as follows: GER – Germany; FRA – France; SRB – Serbia; LIT – Lithuania; CR – Czech Republic; MOL – Moldova; MOR – Morocco; and ESP – Spain.

opencc-by-4.0Mar 2019View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record