Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
3,292
datasets available to search
ShareScore release 0.9.0
Dataset results
3,292 results for “DNA Barcode”
Figures 1-6 in Status of Chrysodeixis chalcites Esper and Chrysodeixis eriosoma (Doubleday) of family Noctuidae (Lepidoptera) in India as determined by DNA barcoding and morphological characterization
Figures 1-6. Chrysodeixis acuta (Walker) 1. Habitus photograph of male, 2. Habitus photograph of female, 3. Male genitalia attached with aedeagus, 4. Male genitalia, 5. Female genitalia, 6. Aedeagus.
Table 1 in DNA barcoding of the genus Verbascum (Scrophulariaceae) in the Arabian Peninsula
<p><b>Table 1.</b> PCR Primers used for amplification in DNA regions.</p><table><tbody><tr><th>Region</th><th>Primer</th><th>Sequence (5′–3′)</th><th>Reference</th></tr></tbody><tbody><tr><th><i>rbcL</i></th><td>rbcLa-F rbcLa-R</td><td>ATGTCACCACAAACAGAGACTAAAGC GTAAAATCAAGTCCACCRCG</td><td>Levin & al. (2003)</td></tr><tr><th><i>matK</i></th><td>matK472F matK1248R</td><td>CCCRTYCATCTGGAAATCTTGGTTC GCTRTRATAATGAGAAAGATTTCTGC</td><td>Yu & al. (2011)</td></tr><tr><th><i>trnL</i></th><td>trnL-f trnL-c</td><td>ATTTGAACTGGTGACACGAG CGAAATCGGTAGACGCTACG</td><td>Taberlet & al. (1991)</td></tr><tr><th>ITS</th><td>ITS2F ITS3R</td><td>ATGCGATACTTGGTGTGAAT GACGCTTCTCCAGACTACAAT</td><td>Chen & al. (2010)</td></tr></tbody></table>
Fig. 6 in DNA barcoding of some Pandeidae species (Cnidaria, Hydrozoa, Anthoathecata)
Fig. 6. Neoturris pileata, preserved specimen (MHNG-INVE-35522) from the Mediterranean, collected before 1895 and identified by C. Hartlaub. Note that the bell shape is not elongated as often seen in other illustrations (e.g. Fig. 7), but nevertheless lies within the range of variation for Mediterranean specimens. Moreover, the bell is somewhat flattened in this preserved sample.
Fig. 4. A in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 4. A maximum-likelihood phylogenetic tree of the genus Hymenolepis. The tree was made with sequences of mitochondrial cox1 (456 nucleotide sites) under the substitutional model GTR+G+I. The isolates of this study (18AK285, 19AK270, H22B, JA173, JA175, JA220, and JA244) are shown in bold face. The DNA accession number of each taxon is shown in parenthesis. Rodentolepis nana (accession no. LC063187) was used as an outgroup taxon.
Fig. 8. A in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 8. A maximum-likelihood phylogenetic tree of the genus Catenotaenia. The tree was made with 28S rDNA sequences (1208 nucleotide sites) under the substitutional model GTR+G. The isolates of this study (AMU, JA212, and JA317) are shown in bold face. The DNA accession number of each taxon is shown in parenthesis. Hymenolepis diminuta (accession no. AY157181) was used as an outgroup taxon.
Fig. 3 in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 3. Adult tapeworms of Hymenolepis sp. 1, Arostrilepis tenuicirrosa, and Microsomacanthus sp. A, Scolex of Hymenolepis sp. 1; B, mature proglottids of Hymenolepis sp. 1; C, scolex of A. tenuicirrosa; D, mature proglottid of A. tenuicirrosa; E, gravid proglottid of A. tenuicirrosa; F, whole body of Microsomacanthus sp.; G, scolex of Microsomacanthus sp.; H, mature proglottids of Microsomacanthus sp. Scale bars: A, C, G, 200 µm; B, D, 500 µm; E, 1 mm; F, 2 mm; G, 100 µm.
Fig. 6 in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 6. Adult tapeworms of Paranoplocephala kalelai, Catenotaenia sp., and Raillietina sp. A, Scolex of P. kalelai; B, mature proglottid of P. kalelai; C, gravid proglottid of P. kalelai; D, scolex of Catenotaenia sp.; E, mature proglottid Catenotaenia sp.; F, gravid proglottids of Catenotaenia sp.; G, scolex of Raillietina sp.; H, mature proglottids of Raillietina sp. Scale bars: A–C, E, H, 500 µm; D, G, 200 µm; F, 1 mm.
Fig. 5. A in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 5. A maximum-likelihood phylogenetic tree of the genus Arostrilepis. The tree was made with sequences of mitochondrial cytb (558 nucleotide sites) under the substitutional model GTR+G+I. The isolates of this study (19AK170, 19AK439, 19AK454, and 19AK459) are shown in bold face. The DNA accession number of each taxon is shown in parenthesis. Hymenolepis diminuta (accession no. AF314223) was used as an outgroup taxon.
Fig. 2. A in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 2. A maximum likelihood phylogenetic tree of the families Hymenolepididae, Anoplocephalidae, Catenotaeniidae, and Davaineidae. The tree was made with sequences of 28S rDNA (1137 nucleotide sites) under the substitutional model GTR+G. The isolates of this study (19AK270, JA175, 19AK170, JA313, 19AK378, AMU, and Para33SI) are shown in bold face. The DNA accession number of each taxon is shown in parenthesis. Bootstrap percentages are shown on each node. Scale bar indicates the number of substitutions per nucleotide site. Dibothriocephalus nihonkaiensis (accession no. LC474508) was used as an outgroup taxon.
Fig. 1 in Cestode fauna of murid and cricetid rodents in Hokkaido, Japan, with assignment of DNA barcodes
Fig. 1. Maps of the Japanese Archipelago and Hokkaido. Arrows indicate the southward and northward movements of terrestrial mammals in the Pleistocene glacial epoch. Rodent sampling sites are shown as open circles.
Fig. 2 in Meiobenthic Polychaete Dinophilus sp. cf. gyrociliatus (Annelida: Dinophilidae) from Japan with SEM Observation and DNA Barcodes
Fig. 2. SEM images of Dinophilus sp. cf. gyrociliatus (RCMB, ICHUM-6114). A, Whole specimen, dorsal view, numbers indicate ciliary bands; B, anterior end, dorsal view; C, anterior end, ventral view; D, whole specimen, ventral view; E, anterior end, dorsolateral view, showing nuchal organ (arrow); F, posterior end, dorsal view. Scale bars: A, D, 300 µm; B, C, 100 µm; E, F, 50 µm.
Fig. 4 in Meiobenthic Polychaete Dinophilus sp. cf. gyrociliatus (Annelida: Dinophilidae) from Japan with SEM Observation and DNA Barcodes
Fig. 4. Dinophilus sp. cf. gyrociliatus, live specimens (RCMB, no voucher remains) cultured from the same parent of the specimens that was used for the molecular work. A, Dwarf male, dorsal view; B, dwarf male, lateral view; C, dwarf male (arrowhead) in an egg capsule together with a female (indicated by an arrow); D, dwarf male in an egg capsule left by a female. Scale bars: A, C, D, 50 µm; B, 20 µm.
Fig. 1 in Meiobenthic Polychaete Dinophilus sp. cf. gyrociliatus (Annelida: Dinophilidae) from Japan with SEM Observation and DNA Barcodes
Fig. 1. Dinophilus sp. cf. gyrociliatus, live female specimen (RCMB, non-deposited specimen, cultured from the same parent of the specimens that was used for the molecular work). A, Stereoscopic microscope image, dorsal view; B, light microscopic image, dorsal view. Arrows indicate eggs. Scale bars: A, B, 100 µm.
Fig. 3 in Meiobenthic Polychaete Dinophilus sp. cf. gyrociliatus (Annelida: Dinophilidae) from Japan with SEM Observation and DNA Barcodes
Fig. 3. SEM images of Dinophilus sp. cf. gyrociliatus (MMBS, ICHUM-6115). A, Whole specimen, dorsal view; B, anterior end, dorsal view; C, anterior end, ventral view; D, whole specimen, ventral view. Scale bars: A, 100 µm; B, C, 50 µm; D, 200 µm.
Fig. 3. Pseudione nephropsi Shiino, 1951. A–D in Topotype-based DNA Barcode of the Parasitic Isopod Pseudione nephropsi (Bopyridae), with a Supplementary Morphological Description
Fig. 3. Pseudione nephropsi Shiino, 1951. A–D, female; E, F, male. A, left antenna 1, ventral view; B, left antenna 2, ventral view, with most portion of basal segment (bs) omitted; b1, distal region of left antenna 2, ventral view, with most setae omitted; C, E, left pereopod 1; D, F, left pereopod 7. Scales: 0.1 mm (A, B, E, F), 0.05 mm (b1), 0.5 mm (C, D).
Fig. 1. Pseudione nephropsi Shiino, 1951 in Topotype-based DNA Barcode of the Parasitic Isopod Pseudione nephropsi (Bopyridae), with a Supplementary Morphological Description
Fig. 1. Pseudione nephropsi Shiino, 1951 parasitizing Metanephrops japonicus (Tapparone-Canefri, 1873), fresh specimens. A, M. japonicus infested by bopyrids; B, C, female P. nephropsi extracted from host, dorsal (B) and ventral (C) views, with attached male (arrow). Scales: 50 mm (A), 5 mm (B, C).
Fig. 2. Pseudione nephropsi Shiino, 1951, fixed specimens. A–H in Topotype-based DNA Barcode of the Parasitic Isopod Pseudione nephropsi (Bopyridae), with a Supplementary Morphological Description
Fig. 2. Pseudione nephropsi Shiino, 1951, fixed specimens. A–H, female; I–O, male. A, head, dorsal view; B, left barbula, ventral view; C, D, left oostegite 1, ventral (C) and dorsal (D) views; E, F, left pereopods 1 and 7, respectively; G, tubercles on right pleopods, ventral view; H, posterior region of body, dorsal view; I, body, dorsal view; J, head, dorsal view; K, L, left pereopods 1 and 7, respectively; M, N, pleon, ventral (M) and slightly-left, ventral (N) views; O, pleomere 6, dorsal view. Abbreviations: pl1, pleopod 1; pl1e, exopodite of pleopod 1; ur, uropod. Arrows, anal cone. Scales: 1 mm (A–I), 0.5 mm (M, N), 0.1 mm (J–L, O).
Fig. 20. Aphelopus wushensis Olmi, 2010 in DNA barcoding of Aphelopus Dalman (Hymenoptera, Dryinidae) from China, with descriptions of four new species
Fig. 20. Aphelopus wushensis Olmi, 2010, ♀ (SCAU 3040509). A. Habitus, dorsal view. B. Habitus, lateral view. C. Head and mesosoma, dorsal view. D. Head and mesosoma, lateral view.
Fig. 21 in DNA barcoding of Aphelopus Dalman (Hymenoptera, Dryinidae) from China, with descriptions of four new species
Fig. 21. Aphelopus zhaoi Xu, He & Olmi, 1998, ♀ (SCAU 3011659). A. Habitus, dorsal view. B. Habitus, lateral view. C. Head and mesosoma, dorsal view. D. Head and mesosoma, lateral view.
Fig. 19 in DNA barcoding of Aphelopus Dalman (Hymenoptera, Dryinidae) from China, with descriptions of four new species
Fig. 19. Aphelopus spadiceus Xu & He, 1997, ♂ (SCAU 3040510). A. Habitus, dorsal view. B. Habitus, lateral view. C. Head and mesosoma, dorsal view. D. Head and mesosoma, lateral view.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.