Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
1,197
datasets available to search
ShareScore release 0.9.0
Dataset results
1,197 results for “FLEXIBILITY”
PyVOLCANS: A Python package to flexibly explore similarities and differences between volcanic systems
<p>Python tool to identify analogue volcanoes via <a href="https://doi.org/10.1007/s00445-019-1336-3">VOLCANS</a>.</p> <p>The main goal of PyVOLCANS is to help alleviate data-scarcity issues in volcanology, and contribute to developments in a range of topics, including (but not limited to): quantitative volcanic hazard assessment at local to global scales, investigation of magmatic and volcanic processes, and even teaching and scientific outreach. We hope that future users of PyVOLCANS will include any volcano scientist or enthusiast with an interest in exploring the similarities and differences between volcanic systems worldwide. Please visit our <a href="https://github.com/BritishGeologicalSurvey/pyvolcans/wiki">wiki pages</a> for more information.</p>
Flexible use of memory by food-caching birds
<p>Animals use memory-guided and memory-independent strategies to make navigational decisions. Disentangling the contribution of these strategies to navigation is critical for understanding how memory influences behavioral output. To address this issue, we studied spatial behaviors of the chickadee, a food-caching bird. Chickadees hide food in concealed, scattered locations and retrieve their caches later in time. We designed an apparatus that allows birds to cache and retrieve food at many sites while navigating in a laboratory arena. This apparatus enabled automated tracking of behavioral variables – including caches, retrievals, and investigations of different sites. We built probabilistic models to fit these behavioral data using a combination of mnemonic and non-mnemonic factors. We found that chickadees use some navigational strategies that are independent of cache memories, including opportunistic foraging and spatial biases. They combine these strategies with spatially precise memories of which sites contain caches and which sites they have previously checked. A single memory of site contents is used in a context-dependent manner: during caching chickadees avoid sites that contain food, while during retrieval they instead preferentially access occupied sites. Our approach is a powerful way to investigate navigational decisions in a natural behavior, including flexible contributions of memory to these decisions.</p>
The Regional Coupled Suite (RCS): application of a flexible regional coupled modelling framework to the Indian region at km-scale
<p>Supporting data for figures in GMD draft paper: The Regional Coupled Suite (RCS): application of a flexible regional coupled modelling framework to the Indian region at km-scale.</p>
Flexible diets enable pollinators to cope with changes in plant community composition
<p><span>Switching plant species visited by pollinators (partner flexibility), has been proposed as a behavioural mechanism able to attenuate the negative impacts of shifts in plant communities on pollination. However, it is unclear if the magnitude of such response is generalizable or depends on the environmental context. Moreover, the ability of pollinators to exploit plants with dissimilar traits (trait flexibility) has been overlooked, even though it can affect the spectrum of new partners available. </span></p> <p><span>To shed some light on this problem, we quantified partner and trait flexibility in five communities from four different environments, from Alpine to semi-arid. We evaluated if the rate at which pollinators incorporated new plant species throughout the flowering season was similar across communities or context-dependent. Then, we assessed if pollinators changed the type of flowers visited and if such trait flexibility was related to their capacity to visit new plant species. Finally, we developed an agent-based model to explore if diet flexibility can protect pollination when the plant community changes. To this end, we used scenarios of phenological decoupling.</span></p> <p><span>In general, pollinators switched interaction partners to cope with the temporal replacement of plant species. Yet, the magnitude of such behaviour varied across communities, probably in response to differences in the number of floral resources available. Also, pollinators were able to visit plant species with dissimilar traits, though both components of diet flexibility (partner identity and traits) did not necessarily covary. Thus, to have a full picture of pollinators' diet flexibility we need to consider the floral traits of partners. Finally, our theoretical model shows that diet flexibility can protect pollination after shifts in plant communities; but that such positive effects are limited by trait-matching between co-occurring species.</span></p> <p><span><span>Overall, our study highlights the importance of incorporating plant traits when evaluating the ability of pollinators to find new interaction partners. Besides, our simulation results suggest that diet flexibility may not unequivocally protect pollination against changes in plant communities, especially if they entail shifts in the characteristics of the floral assemblage, and hence, the ability of pollinators to find new interaction partners can be compromised.</span></span></p>
Expanding the Concept of Comprehensive Area Ratio Parameter to the South-Central States: Towards Simplifying the Structural Evaluation of Flexible Pavements at the Network Level
<p>The surface deflection bowl data collected through falling weight deflectometer (FWD) test is utilized by highway agencies in assessing the performance of the flexible pavement. However, a robust method to evaluate pavement sections utilizing FWD data from all the sensors is seldom developed. There is always a need for DOTs and highway agencies to have a simplified procedure, which can be directly implemented in agencies' databases. This study focuses on expanding and validating the concept of previously developed area ratio parameters towards the pavement section of South-Central States (Arkansas, Louisiana, New Mexico, Oklahoma, and Texas) in effectively analyzing the pavement performances. Simulation-based deflections are utilized to develop enhanced deflection-based parameters and to reduce the need for extensive FWD testing in the field. Ninety-seven pavement sections in these states are considered to implement and validate simplified procedures that will be readily available to various transportation agencies to evaluate their pavement conditions at the network level. Due to this purpose, a pavement ranking chart is proposed for the five South-Central states, which categorizes the pavement section into very good, good, fair, and poor pavement sections. Eventually, load-induced effects concerning developed parameters are effectively analyzed to predict the remaining service life of the flexible pavement structures. The developed methodologies will be helpful for DOTs and highway agencies to carry out the rehabilitation and maintenance work in time and estimate the budget required in these procedures.</p>
Data from: The origins of cognitive flexibility in chimpanzees
<p>Cognitive flexibility is a core component of executive function, a suite of cognitive capacities that enables individuals to update their behavior in dynamic environments. Human executive functions are proposed to be enhanced compared to other species, but this inference is based primarily on neuroanatomical studies. To address this, we examined the nature and origins of cognitive flexibility in chimpanzees, our closest living relatives. Across three studies, we examined different components of cognitive flexibility using reversal learning tasks where individuals first learned one contingency and then had to shift responses when contingencies flipped. In Study 1, we tested n = 82 chimpanzees ranging from juvenility to adulthood on a spatial reversal task, to characterize the development of basic shifting skills. In Study 2, we tested how n = 24 chimpanzees use spatial versus arbitrary perceptual information to shift, a proposed difference between human and nonhuman cognition. In Study 3, we tested n = 40 chimpanzees on a probabilistic reversal task. We found an extended developmental trajectory for basic shifting and shifting in response to probabilistic feedback—chimpanzees did not reach mature performance until late in ontogeny. Additionally, females were faster to shift than males were. We also found that chimpanzees were much more successful when using spatial versus perceptual cues, and highly perseverative when faced with probabilistic versus consistent outcomes. These results identify both core features of chimpanzee cognitive flexibility that are shared with humans, as well as constraints on chimpanzee cognitive flexibility that may represent evolutionary changes in human cognitive development.</p>
Data from: Hierarchical variation in phenotypic flexibility across timescales and associated survival selection shape the dynamics of partial seasonal migration
<p>Population responses to environmental variation ultimately depend on within-individual and among-individual variation in labile phenotypic traits that affect fitness, and resulting episodes of selection. Yet, complex patterns of individual phenotypic variation arising within and between time periods, and associated variation in selection, have not been fully conceptualised or quantified. We highlight how structured patterns of phenotypic variation in dichotomous threshold traits can theoretically arise and experience varying forms of selection, shaping overall phenotypic dynamics. We then fit novel multistate models to ten years of band-resighting data from European shags to quantify phenotypic variation and selection in a key threshold trait underlying spatio-seasonal population dynamics: seasonal migration versus residence. First, we demonstrate substantial among-individual variation alongside substantial between-year individual repeatability in within-year phenotypic variation ('flexibility'), with weak sexual dimorphism. Second, we demonstrate that between-year individual variation in within-year phenotypes ('supraflexibility') is structured and directional, consistent with the threshold trait model. Third, we demonstrate strong survival selection on within-year phenotypes, and hence on flexibility, that varies across years and sexes, including episodes of disruptive selection representing costs of flexibility. By quantitatively combining these results, we show how supraflexibility and survival selection on migratory flexibility jointly shape population-wide phenotypic dynamics of seasonal movement.</p>
Cognitive flexibility supports the development of cumulative cultural learning in children
<p><span>The scale of cumulative cultural evolution (CCE), the improvement of cultural traits over generations via social transmission, is widely believed to be one of humans' most defining characteristics. Our capacity to build upon others' knowledge, skills, and technologies has produced the most diverse and complex technological repertoire on the planet. Despite growing interest in the field of CCE, the cognitive underpinnings supporting its development remain relatively understudied. In this study, we examined the role that cognitive flexibility plays in supporting cumulative cultural learning by studying U.S. children's (</span><span>N</span><span> = 167, 3-5-year-olds) propensity to relinquish an inefficient solution to a problem in favor of a more efficient alternative. We also examined whether children would resist revertin</span><span>g</span><span> back to earlier versions and omit redundant actions from previous behaviors. In contrast to previous work with chimpanzees, most children who first learned to solve a puzzlebox in a highly inefficient way switched to an observed, more efficient alternative. However, over multiple task interactions, 85% of children who did switch also reverted back to the original, inefficient method. Moreover, almost all children in a control condition (who first learned the efficient method before observing the inefficient method) switched to the inefficient method. This suggests that </span><span>children were keen to explore an alternative modeled solution but were overall conservative in reverting to their first-learned method across subsequent task interactions. We discuss these findings in the context of their implications for the cognitive ontogeny of CCE.</span></p>
E. coli-ΦX174 genotype to phenotype map reveals flexibility and diversity in LPS structures
<p>Here are the raw sequencing data of all <em>E. coli</em> C and ΦX174 strains obtained during this study. A short description of each file's content can be found below.</p> <p> </p> <p><em>Bacteria</em></p> <ul> <li>"E.coliC_res.zip": Whole genome sequencing results of <em>E. coli</em> C WT and ΦX174-resistant strains (generated by fluctuation experiments). All<em> E. coli</em> C samples were prepared for whole-genome sequencing from one millilitre of stationary-phase cultures. Genomic DNA was extracted using the Wizard® Genomic DNA purification Kit (Promega, Germany). Bacterial samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany) using an Illumina Nextera DNA Flex Library Prep Kit to produce 150 bp paired-end reads.</li> </ul> <p> </p> <ul> <li>"E.coliC_res_excluded.zip": Whole genome sequencing results of the four ΦX174-resistant <em>E. coli</em> C strains (generated by fluctuation experiments) that have been excluded from the analyses<em>: E. coli </em>C R1, R3, R15, and R19. We found that both<em> E. coli</em> C R3 and R15 were not isogenic. While whole-genome sequencing from their respective glycerol stocks showed only a single mutation in <em>galE</em>, whole-genome sequencing carried on colony re-streaks showed that additional mutations were systematically associated with the single mutation in <em>galE</em> (<strong>see file "E.coliC_res_excluded_10_clones</strong>). <em>E. coli</em> C R1 displayed an unstable resistant phenotype. Finally, <em>E. coli</em> C R19 was partially resistant to ΦX174 WT. It carries a single mutation in the <em>yajC</em> gene, which encodes for a periplasmic protein. No apparent link to the LPS biosynthesis or assembly has been discovered yet, but <em>yajC</em> might play a role in phage DNA injection into the bacterium’s cytoplasmic membrane.</li> </ul> <p> </p> <ul> <li>"E.coliC_res_excluded_10_clones.zip": Whole genome sequencing results of 10 randomly chosen isolates of<em> E. coli </em>C R1, R3, and R15.</li> </ul> <p> </p> <ul> <li>"EcoliC.gb": <em>E. coli</em> C WT strain used as reference.</li> </ul> <p> </p> <p><em>Bacteriophages</em></p> <p> </p> <ul> <li>“PhiX174_PCR_399r_400f.zip”: ΦX174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5® High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of ΦX174 whole genome are:</li> </ul> <p> </p> <p>PhiX174_399_r: CTTGACTCATGATTTCTTACC</p> <p>PhiX174_400_f: TTACTGAACAATCCGTACGTTTC</p> <p> </p> <p>DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads.</p> <p> </p> <ul> <li>“PhiX174_PCR_2361r_2362f.zip”: ΦX174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5® High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of ΦX174 whole genome are:</li> </ul> <p> </p> <p>PhiX174_2361_r: TCGCTTGGTCAACCCCTCAG</p> <p>PhiX174_2362_f: AGCGCGGTAGGTTTTCTGCT</p> <p> </p> <p>DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads.</p> <ul> <li>“PhiX174_excluded.zip”: Since we removed R19 from the final analysis, we also removed its corresponding evolved phage obtained during the first evolution experiment (ΦX174 R19 T1). We also removed the phage infecting R5 (ΦX174 R5 T2) because it was not isogenic (confirmed by Sanger Sequencing).</li> </ul> <ul> <li>“PhiX174_Sequencing_Sanger.zip”: Both <em>F</em> and <em>H</em> genes were amplified by performing 35 cycles of PCR using Phusion® High-Fidelity PCR Master Mix with HF Buffer. The sequencing primers are listed in the<strong> Information_Sanger_Samples_ID.xlsx</strong> file.</li> </ul> <p> </p> <ul> <li>“PhiX174_ref.gb”: PhiX174 WT strain used as reference.</li> </ul> <p> </p> <p>We also include the raw data and pictures from our spotting tests and plaque assays used to complete the final matrix of infection.</p> <ul> <li>Spotting_tests_reanalyzed.xlsx”: Raw data from the pictures (see <strong>Photos_matrices</strong><strong>.zip</strong>) used to generate the Hierarchical agglomerative clustering analysis of the host ranges of evolved phage and Infection matrix of evolved ΦX174 phages on the 31 resistant E. coli C strains.</li> </ul> <p>The <strong>Photos_matrices</strong><strong>.zip</strong> folder contains</p> <p> </p> <ul> <li>“SSA_matrix_Bact_Lawn”: pictures of all evolution experiments obtained from the spotting test method where we spotted phages on bacterial lawns.</li> </ul> <p> </p> <ul> <li>“SSA_matrix_Phi_Lawn”: pictures of all evolution experiments obtained from the spotting test method where we spotted bacteria on phage lawns.</li> </ul> <p> </p> <ul> <li>“Mismatches”: We performed plaque assays when combinations of phages and bacteria showed discrepancies between the two spotting test methods</li> </ul> <p> </p> <ul> <li>“Plaque_assays_R12_R14”: pictures of plaque assays where we tested the sensitivity of <em>E. coli</em> C R12 and R14 toward a subset of evolved phages</li> </ul> <p> </p> <ul> <li>“Plaque_assays_of_PhiX174R22T1c1/R28T1c1_vs_WT”: pictures of plaque assays where we tested the sensitivity of <em>E. coli</em> C WT toward phages infecting R22 and R28.</li> </ul> <p> </p> <ul> <li>“displayImage.R”. Script made to look for the desired combination of phage and bacterium.</li> </ul> <p> </p> <p>Finally, we include the raw OD measurments:</p> <p> </p> <ul> <li>“All_EcoliC_growth_raw_data.xlsx”: raw OD measurements of each <em>E. coli</em> C resistant strains used in this study.</li> </ul>
Flexibility solutions - making the power grid fit for the future
<p><b>Abstract</b></p><p class="dhik-abstract-content">The competence center Business Engineering presents different projects. QualyGridS: flexible hydrogen production, business ecosystem design; PACE: optimized operation of FC µCHPs, operations research, market analysis; - Multiple Benefits: valuation of MB of energy efficiency measures; smart services, CE, LCA</p><p></p><p><b>Weitere Beiträge aus dem DHIK-Forum 2022 auf Zenodo:</b></p><p class="dhik-session-list"></p><ul><li>Session #1: Viktor Sigrist: Internationalisierung - Partnerschaften für den Ausbau von Forschung und Entwicklung (DOI:<a href="https://zenodo.org/record/7123701">10.5281/zenodo.7123701</a>)</li><li>Session #2: Dieter Leonhard: DHIK- Strategien der internationalen Zusammenarbeit in Forschung und Lehre (DOI:<a href="https://zenodo.org/record/7123456">10.5281/zenodo.7123456</a>)</li><li>Session #3: Stephen Wittkopf: Wissens- und Innovationstransfer - Interdisziplinäre Zusammenarbeit mit Unternehmen und Institutionen (DOI:<a href="https://zenodo.org/record/7025707">10.5281/zenodo.7025707</a>)</li><li>Session #4: Xiao Feng: CDHAW - Chinesisch-Deutsche Hochschule für Angewandte Wissenschaften (DOI:<a href="https://zenodo.org/record/7123458">10.5281/zenodo.7123458</a>)</li><li>Session #5: Antonio Pita und Isabel Kreiner: Academy-Industry-Collaboration - Outreach Strategy (DOI:<a href="https://zenodo.org/record/7123460">10.5281/zenodo.7123460</a>)</li><li>Session #6: Martin Sternberg: Promotionsrecht – aktueller Stand an deutschen Hochschulen für angewandte Wissenschaften (DOI:<a href="https://zenodo.org/record/7123757">10.5281/zenodo.7123757</a>)</li><li>Session #7: Adrian Derungs: Duo mit Innovationskraft - Zusammenspiel von Forschung und Wirtschaft in der Zentralschweiz (DOI:<a href="https://zenodo.org/record/7123767">10.5281/zenodo.7123767</a>)</li><li>Session #8: Theres Paulsen: Transdisziplinäre Forschung - komplexe gesellschaftliche Herausforderungen erfordern diverse Ansätze (DOI:<a href="https://zenodo.org/record/7123769">10.5281/zenodo.7123769</a>)</li><li>Session #9: Jörg Schneider: International research collaboration - New funding opportunities for universities of applied sciences (DOI:<a href="https://zenodo.org/record/7123771">10.5281/zenodo.7123771</a>)</li><li>Session #10: Cornelia Spycher und Matthew Whellens: Horizon Europe - overview of funding opportunities for your research and innovation (DOI:<a href="https://zenodo.org/record/7123773">10.5281/zenodo.7123773</a>)</li><li>Session #11: Janique Siffert: Eureka Eurostars - erfolgreiche Förderung für internationale Innovationsprojekte (DOI:<a href="https://zenodo.org/record/7123777">10.5281/zenodo.7123777</a>)</li><li>Session #12: Ludger Fischer: Energy Lab - ein Netzwerk für innovative Lösungen im Energiebereich (DOI:<a href="https://zenodo.org/record/7123779">10.5281/zenodo.7123779</a>)</li><li>Session #13: Jörg Worlitschek: Thermal energy storage - heating the north, cooling the south (DOI:<a href="https://zenodo.org/record/7123781">10.5281/zenodo.7123781</a>)</li><li>Session #14: Jonas Mühlethaler: Neues DC Microgrid-Konzept – netzunabhängige Elektrifizierung in Entwicklungsländern (DOI:<a href="https://zenodo.org/record/7123783">10.5281/zenodo.7123783</a>)</li><li>Session #15: Tommy Claussen: Dekarbonisierung des Gebäudesektors - digitale Transformation in der Gebäudetechnik und im Gebäudemanagement (DOI:<a href="https://zenodo.org/record/7123785">10.5281/zenodo.7123785</a>)</li><li><b>Session #16: Christoph Imboden: Flexibility solutions - making the power grid fit for the future (<a href="#collapseTwo">Video</a>)</b></li><li>Session #17: Uwe Schulz: Spielerisches Sarnetz - Simulationen für die fossile Unabhängigkeit einer Ortschaft (DOI:<a href="https://zenodo.org/record/7123790">10.5281/zenodo.7123790</a>)</li><li>Session #18: Jana Koehler: Künstliche Intelligenz – Erfolg durch Erwünschtheit, Machbarkeit und Wirtschaftlichkeit (DOI:<a href="https://zenodo.org/record/7123792">10.5281/zenodo.7123792</a>)</li><li>Session #19: Rolf Kamps: KI in der Prävention - Befragungsmethoden und Schulungen trainieren, Krankheitserreger erkennen (DOI:<a href="https://zenodo.org/record/7123794">10.5281/zenodo.7123794</a>)</li><li>Session #20: Gwendolyne Pascua: Artificial Intelligence in Space - CIMON assisting astronauts on the International Space Station (DOI:<a href="https://zenodo.org/record/7123796">10.5281/zenodo.7123796</a>)</li><li>Session #21: Tobias Matter et.al.: Augmented Reality Soundscapes - mit maschinellem Lernen Klangkulissen von zukünftigen Bauvorhaben generieren (DOI:<a href="https://zenodo.org/record/7123798">10.5281/zenodo.7123798</a>)</li><li>Session #22: Angela Nicoara: Internet of Things - transforming businesses, people's lives and driving growth in the coming years (DOI:<a href="https://zenodo.org/record/7123800">10.5281/zenodo.7123800</a>)</li><li>Session #23: Adrian Koller: Feldrobotik - unermüdliche und zunehmend intelligentere Hilfe in der Landwirtschaft (DOI:<a href="https://zenodo.org/record/7123802">10.5281/zenodo.7123802</a>)</li><li>Session #24: Widar von Arx et.al.: Realisierung der Verkehrswende - Einfluss der Preispolitik in der Mobilität (DOI:<a href="https://zenodo.org/record/7124000">10.5281/zenodo.7124000</a>)</li><li>Session #25: Andreas Liebrich: Tourismusdateninfrastruktur - Was die Schweiz von Europa lernen kann (DOI:<a href="https://zenodo.org/record/7123806">10.5281/zenodo.7123806</a>)</li><li>Session #26: Frank Pöhlau und Stefan May: Find life on Mars - Schülerprojekte zur mobilien Robotik (DOI:<a href="https://zenodo.org/record/7123808">10.5281/zenodo.7123808</a>)</li><li>Session #27: Jiayun Shen: Open Innovation - Innovationsmanagement bei der Schweizerischen Post (DOI:<a href="https://zenodo.org/record/7123810">10.5281/zenodo.7123810</a>)</li><li>Session #28: Tobias Specker: Interkulturelles Management – innovative Konzepte zum Ausbau der China-Kompetenzen an Hochschulen (DOI:<a href="https://zenodo.org/record/7123812">10.5281/zenodo.7123812</a>)</li><li>Session #29: Elena Algorri: Swimming robots - exploring the unterwater from the surface (DOI:<a href="https://zenodo.org/record/7123814">10.5281/zenodo.7123814</a>)</li><li>Session #30: Sergio Camacho: Robotics and Digital Systems Engineering at the Tec de Monterrey (DOI:<a href="https://zenodo.org/record/7123816">10.5281/zenodo.7123816</a>)</li><li>Session #31: Thomas Dorn: Industrie 4.0 - Forschungskooperationen mit der CDHAW und der Tongji Universität Shanghai (DOI:<a href="https://zenodo.org/record/7123818">10.5281/zenodo.7123818</a>)</li><li>Session #32: Walter Reichert et.al.: Kollaboration und Unterstützung - Mobile Robotik und Exoskelette in der flexiblen Produktion (DOI:<a href="https://zenodo.org/record/7123820">10.5281/zenodo.7123820</a>)</li><li>Session #33: Louis Palmer: Solar Butterfly - climate pioneer world tour supported by HSLU (DOI:<a href="https://zenodo.org/record/7123822">10.5281/zenodo.7123822</a>)</li></ul><p></p>
Data for "Tetramine Aspect Ratio and Flexibility Determine Framework Symmetry for Zn8L6 Self-Assembled Structures"
<p>In the following subdirectories are the input and outputs of cage and face analysis for:</p> <p>Published DOI: <a href="https://onlinelibrary.wiley.com/doi/full/10.1002/anie.202217987">10.1002/anie.202217987 </a></p> <p>Code: <a href="https://github.com/andrewtarzia/sca_cage_assembler/tree/cubism-production">sca_cage_assembler</a></p> <p>Previously uploaded in 10.5281/zenodo.8432296 and <a href="https://github.com/andrewtarzia/citable_data" rel="noopener noreferrer">https://github.com/andrewtarzia/citable_data</a></p> <p>NOTES:</p> <ul> <li>the naming convention differs from manuscript:</li> </ul> <table> <tbody> <tr> <th>manuscript tetra-aniline</th> <th>computational label</th> <th>xtal-label</th> </tr> <tr> <td>A</td> <td>5</td> <td>370</td> </tr> <tr> <td>B</td> <td>16</td> <td>326</td> </tr> <tr> <td>C</td> <td>12</td> <td>235</td> </tr> <tr> <td>D</td> <td>3</td> <td>301</td> </tr> <tr> <td>E</td> <td>8</td> <td>257</td> </tr> <tr> <td>F</td> <td>2</td> <td>354</td> </tr> </tbody> </table> <ul> <li>computational labels are often preceded by `quad2_` or `cl1_quad2_`</li> <li>much of the analysis was not used in the manuscript but remains part of the accumulated data</li> </ul> <p> </p> <p>cage_library directory:</p> <ul> <li>_CS.json: information on all cages in the set of diastereomers - properties and whether they optimized successfully.</li> <li>_ligand_measures.json: information on the ligand associated with a set of cage diastereomers.</li> <li>_measures.json: represenets a cleaned up collation of all measures the diastereomers made from a given ligand</li> <li>C_NAME_optc.mol: optimized (at xTB level) structure of each cage.</li> <li>set_dft_run directory contains the input and output of the CP2K optimisations of one set of diastereomers</li> </ul> <p>complex_library directory:</p> <ul> <li>contains the optimised structures of both complexes</li> </ul> <p>ligand_library directory:</p> <ul> <li>contains `_opt.mol` input ligand structures for cage construction</li> <li>for cap, the input was provided manually in `manual/` directory</li> <li>in `face_analysis` directory: <ul> <li>contains manual_complex directory, with necessary input for face construction</li> <li>_long_properties.json files contains the measurements for the named face (in file name)</li> <li>_long_lopt.mol files contain the optimised structure of the named face, on which analysis was performed</li> <li>`long` corresponds to the longer restricted optimization discussed in the SI.</li> </ul> </li> </ul> <p>xray_structures directory:</p> <ul> <li>analysis directory: <ul> <li>contains input .pdb files for xray structure (as single molecules) used in analysis</li> <li>contains `all_xray_csv_data.csv`, which has all data needed on xray structures.</li> </ul> </li> </ul>
Data for the Article "Maturity Assessment of Grid-Scale Flexibility and Energy Storage Services Towards a Decarbonized Europe"
<p>This dataset includes the data collected form various stakeholders regarding grid-scale flexibility and energy services as part of the SINNOGENES Project.</p>
Techno-economics of Geothermal Power in the Contiguous United States Under Baseload and Flexible Operations (Dataset)
<p>This dataset was created as part of a project that is undergoing journal peer-review. Here is the abstract:</p> <p> </p> <p>As geothermal technology continues to gain momentum, it becomes increasingly essential for stakeholders to assess the economic feasibility of geothermal power projects when integrated into electricity markets. This study aimed to evaluate the techno-economic viability of identified and undiscovered hydrothermal systems across the contiguous United States. Multiple data and methods were developed and integrated to model the lifecycle techno-economics of geothermal projects at hourly resolution. Additionally, flexible operations through wellhead throttling were evaluated to estimate the potential improvement compared to business-as-usual power plant operations. A total of 3,632 and 17,789 MWe of identified and undiscovered hydrothermal resources, respectively, were found to be economically competitive. Multiple sites were profitable under a typical 70 USD/MWh power purchase agreement, with return on investment close to 400%. However, operating in the open power market yielded non-profitable projects across the majority of sites. Opting for flexible dispatch resulted in an improved economic performance. Particularly, the most profitable site had nearly 20\% relative improvement in return on investment upon switching from baseload to flexible dispatch.</p>
Safety Through Visibility: Tracing Hydrogen in Colors with Highly Customizable and Flexibly Applicable Supraparticle Additives
<p><span>This data publication is based on the metadata and datasets underlying the manuscript: <br>"Safety Through Visibility: Tracing Hydrogen in Colors with Highly Customizable and Flexibly Applicable Supraparticle Additive"</span></p> <p><span>Abstract:<br>The flammability of H2-air mixtures demands timely detection and precise localization of H2 leakages to ensure safety and targeted maintenance measures in the anticipated hydrogen economy. Herein, H2 indicator supraparticles (SPs) are demonstrated that meet this demand by making H2 visible to the naked eye by a rapid (ir)reversible color change. Their toolbox-like manufacturing from SiO2 nanoparticles (NPs), Pt NPs, and indicator dye molecules via spray-drying allows for engineering their structure, texture, and detection performance by systematically tuning their composition. It is demonstrated that decreasing the SiO2 NP size, increasing the Pt NP concentration, and adjusting the amount of dye molecules improve the SPs’ response times. This opens up the option for multidimensional customization of their detection performance. Furthermore, the toolbox of H2 indicator SPs containing the established resazurin system is expanded to other indicator dyes, which makes a color change and reversibility of choice feasible. H2 indicator SPs meet many of the target characteristics for H2 detectors, e.g., low limit of detection, cycle stability, and high selectivity. Moreover, the SPs’ particulate nature allows for their flexible application as an additive, e.g., in coatings or clothing, which enables the detection and localization of H2 leakages in relevant application scenarios.</span></p> <p><span> </span></p> <p><span>The data collected is from October 2023.** </span></p> <p><span>This file contains information about the instruments, software, materials, chemicals, and datasets used for this study (including processed and raw data of the figures in the manuscript).</span></p> <p><span>A detailed description of the dataset is given in the attached README.txt file.</span></p>
Data from: Flexible oviposition behavior enabled the evolution of terrestrial reproduction
<p>In vertebrates, nearly all oviparous animals are considered to have either obligate aquatic or terrestrial oviposition, with eggs that are specialized for developing in those environments. The terrestrial environment has considerably more oxygen but is dry and thus presents both opportunities and challenges for developing embryos, particularly those adapted for aquatic development. Here, we present evidence from field experiments examining egg-laying behavior, egg size and egg jelly function of 13 species of Central and South American treefrogs in the genus <em>Dendropsophus, </em>which demonstrates that flexible oviposition (individuals laying eggs both in and out of water) and eggs capable of both aquatic and terrestrial development are the likely factors which enable the transition from aquatic to terrestrial reproduction. Nearly half of the species we studied had previously undescribed degrees of flexible oviposition. Species with obligate terrestrial reproduction have larger eggs than species with aquatic reproduction, and species with flexible reproduction have eggs of intermediate sizes. Obligate terrestrial breeding frogs also have egg masses that absorb water more quickly than those with flexible oviposition. We also examined eight populations of a single species, <em>Dendropsophus ebraccatus</em>, and document substantial intraspecific variation in terrestrial oviposition; populations in rainy, stable climates lay fewer eggs in water than those in drier areas. However, no differences in egg size were found, supporting the idea that the behavioral component of oviposition evolves before other adaptations associated with obligate terrestrial reproduction. Collectively, these data demonstrate the key role that behavior can have in facilitating major evolutionary transitions.</p>
Q matrix data for the problems studied using Flexible-PEPS simulator.
<p>How to read the Q matrix:<br><br>Load the dictionary, say as "main_dictionary".</p> <p>Q_dictionary=main_dictionary['Q_dict']</p> <p>Q_dictionary['(x,y)']=value_xy<br><br>value_xy is the Q matrix strength between the vertices (x, y), here x, y are integers starting from 1, to N, where N is the number of qubits (number of variables) in the system.</p>
Flexible modular dwelling for rural environments; specific case: Cebadas – Ecuador
<p><strong><span>Background: </span></strong><span>Sustainable modular dwelling design for rural areas should focus on creating healthy and economically accessible spaces, sensitive to local needs and integrating environmental, functional, sociological and technological aspects. Flexibility is essential to reduce the initial investment and allow future transformations, optimizing the recovery and reuse of materials. These houses must be adaptable, safe and have basic services, satisfying the needs and stages of families’ development. In Ecuador, poverty and energy inefficiency worsen the quality of life in rural areas. This project in the Cebadas parish proposes modular dwelling that applies bioclimatic and sustainable criteria, using local materials to improve habitability and promote the social and economic development of the community.</span></p> <p><strong><span>Method: </span></strong><span>The research approach is qualitative-quantitative. Qualitative, since it is necessary to identify the qualities of the sector, bibliographic exploration of guidelines and sustainable strategies. Quantitative, to evaluate the degree of affectation through a diagnosis of the study site and to provide efficient solutions that respond to the context and social reality. <strong>Results: </strong>The spaces presented in the proposal respond to the spatial need for growth and expansion of the users of the sector, through 6 basic guidelines that this type of dwelling should have: Environment, Visual, Form, Function, Bioclimatic and Materials.</span></p> <p><strong><span>Conclusions: </span></strong><span>The flexible modular dwelling project for rural environments addresses complex housing needs, highlighting the flexibility and adaptability of an expandable module. It includes income generation with a duplex apartment, fosters communal and cultural life with public and commercial spaces, promotes tourism and rural development with landscape design and crops. In addition, it ensures sustainability through bioclimatic strategies and responsible use of resources.</span></p>
Somatic hypermutation-mediated paratope flexibility improves the cross-reactivity of human malaria antibodies -- Molecular Dynamics dataset
<p>4493 Manuscript Data<br>====================</p> <p>author: Anton Hanke<br>size of uncompressed folder: ~19Gb.<br>DOI: 10.5281/zenodo.11470585</p> <p># Standard MD simulation data</p> <p>Standard Simulations were generated with gromacs 2021.5 using the charmm36m forcefield Juli 2021 release tarball (https://mackerell.umaryland.edu/download.php?filename=CHARMM_ff_params_files/charmm36-jul2021.ff.tgz).<br>Post processed (PBC) simulations are structured as follows:<br>Mature generally refers to the wildtype 4493 antibody.</p> <p>- simulations/standardMD<br> |<br> |- prod.mdp example production mdp file used to run all production simulations.<br> |<br> |- mature Mature simulation set. (folder and file naming the same in all simulation directories)<br> | |- {peptide}_{replicate}_prod.gro {peptide} = peptide; {replicate} = standard MD replicate<br> | |- {peptide}_{replicate}_prod.tpr<br> | `- {peptide}_{replicate}_prod_align_noPBC.xtc (10Frames/ns)<br> |<br> |- mature_rerun Additional set of replicates with the wildtype 4493.<br> |- matureCapped Set of simulations with termini capped peptides<br> |- mature_nanpv2 Set of simulations with NPDP similar positioning of NANP<br> |- wo_pep Set of simulations without peptides for germline and mature<br> `- germline Set of germline simulations.</p> <p><br># RAMD simulation data</p> <p>RAMD simulations were generated with gromacs_2020.5 patched with RAMDv2 modified to account for the connected multiple ligand groups.<br>(Source code provided as tar file ./sw/gromacs_ramd_patchv2.tar.gz)</p> <p>Not all trajectories contain an unbinding event (gromacs CUDA bug.). <br>These trajectories were not considered in the analysis of simulations. </p> <p>- simulations/ramd<br> |<br> |- prod.mdp Exemplary production mdp file with RAMD settings, these were used in all trajectories w/<br> | differing RAMD random seed.<br> |<br> |- mature_2.625kcalmolA_4.0_3.0<br> | |- {peptide}_{replicate}_prod_{startFrame}.gro {peptide} = peptide; {replicate} = standard MD replicate; {startFrame} = Frame in standard MD used to start simulation.<br> | |- {peptide}_{replicate}_prod_{startFrame}.tpr<br> | |- {peptide}_{replicate}_prod_{startFrame}.ndx<br> | |- {peptide}_{replicate}_prod_{startFrame}_align_noPBC.xtc (100Frames/ns) Files omited due to size -- available on request.<br> | `- {peptide}_{replicate}_prod_{startFrame}_lastframe.pdb Last frame of the processed RAMD trajectory.<br> `- gl_2.625kcalmolA_4.0_3.0</p> <p><br># Analysis</p> <p>- analysis<br> |<br> |- entropie Quasi harmonic entropy estimation.<br> | |- inp Concatenated & Bootstrapped, coarse-grained and aligned trajectories of all systems<br> | |- out CPPTRAJ runs to calculate QHE on the bootstrapped trajectories<br> | |- run_complex.sh Script running analysis.<br> | |- ana.py Script to calculte average and std of QHE for each system. (generates *.out *.tsv *.png)<br> | |- cg.py Script used to bootstrap, coarse-grain align and build average structure with.<br> | `- delta_entropies.ods Excel file used to calculate Tab 1. in Main text of paper from entropies.out.<br> |<br> |- mmpbsa MMPBSA calculations (MM + SolvEnergy) with gmx_MMPBSA<br> | |- inp Input trajectories and topologies processed for MMPBSA<br> | |- out/gmx_mmpbsa Output directories in which gmx_MMPBSA was run.<br> | | ` *.dat Output files containing calculated energy terms from gmx_MMPBSA.<br> | |- mmpbsa.in MMPBSA input file used to run analysis.<br> | |- plot_results.py Python script to plot correlation of MMPBSA output with experimental data<br> | |- pca_eig_extr.py Script to reduce simulations to regions of high probability density within trajectory (not used in the present analysis)<br> | |- slurm-91315023.out Log file of the analysis run<br> | `- run_mmpbsa.sh Shell script to run the MMPBSA analysis (generates input and output file trees).<br> |<br> `- ramd RAMD analysation.<br> |- run.sh Shell script to run the analysis<br> |- run_ramd_ana.py Python script called by `run.sh` to run the analysis using `ramdAnalysis.py`<br> |- contact_clusters.py Python script to generate plots based on output of the analysis.<br> |- ramdAnalysis.py Python module containing analysis classes called/used within `run_ramd_ana.py`<br> | Based on tauRAMD & Fingerprint analysis by Dr. Daria Khokh (https://doi.org/10.1021%2Facs.jctc.8b00230; https://doi.org/10.1063%2F5.0019088)<br> |- abrun.* Log files from the present run<br> |- *.svg; *.png Analysis output files.<br> |- tramd_patchv2/ Output PDB structures from the analysis (excluded due to size, available on request)<br> `- representatives.pse Pymol session of cluster representatives along unbinding for germline and wildtype with contact probabilities within the<br> cluster mapped as b-factor.</p> <p># Figures</p> <p>- figure_pdbs PDB files (and pymol sessions) used to generate figures in the papers main text.</p>
Polymorphism and flexibility of six-porphyrin nanorings in the solid state
<p>Computational output files and optimized geometries for our research paper.</p>
Design and Implementation of a flexible Node for IoT supporting 6loWPAN and a Sensor Shield for Home Automation Application
<p>Simulation data and measurment of the developed flexible IoT board.</p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.