Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

29

datasets available to search

ShareScore release 0.7.1

Reset

Dataset results

29 results for “Ancient sedimentary DNA”

Learn how ShareScore rates datasets ↗
dryad40/100

Data for: Sedimentary ancient DNA and pollen reveal the composition of plant organic matter in Late Quaternary permafrost sediments of the Buor Khaya Peninsula (north-eastern Siberia)

<p>Organic matter deposited in ancient, ice-rich permafrost sediments is vulnerable to climate change and may contribute to the future release of greenhouse gases; it is thus important to get a better characterization of the plant organic matter within such sediments. From a Late Quaternary permafrost sediment core from the Buor Khaya Peninsula, we analysed plant-derived sedimentary ancient DNA (sedaDNA) to identify the taxonomic composition of plant organic matter, and undertook palynological analysis to assess the environmental conditions during deposition. Using sedaDNA, we identified 154 taxa and from pollen and non-pollen palynomorphs we identified 83 taxa. In the deposits dated between 54 and 51 kyr BP, sedaDNA records a diverse low-centred polygon plant community including recurring aquatic pond vegetation while from the pollen record we infer terrestrial open-land vegetation with relatively dry environmental conditions at a regional scale. A fluctuating dominance of either terrestrial or swamp and aquatic taxa in both proxies allowed the local hydrological development of the polygon to be traced. In deposits dated between 11.4 and 9.7 kyr BP (13.4–11.1 cal kyr BP), sedaDNA shows a taxonomic turnover to moist shrub tundra and a lower taxonomic richness compared to the older samples. Pollen also records a shrub tundra community, mostly seen as changes in relative proportions of the most dominant taxa, while a decrease in taxonomic richness was less pronounced compared to sedaDNA. Our results show the advantages of using sedaDNA in combination with palynological analyses when macrofossils are rarely preserved. The high resolution of the sedaDNA record provides a detailed picture of the taxonomic composition of plant-derived organic matter throughout the core, and palynological analyses prove valuable by allowing for inferences of regional environmental conditions.</p>

opencc-zeroSep 2020View details →
dryad40/100

Permafrost-thaw lake development in Central Yakutia: sedimentary ancient DNA and element analyses from a Holocene sediment record

<p>In Central Yakutia (Siberia) livelihoods of local communities depend on alaas (thermokarst depression) landscapes and the lakes within. Development and dynamics of these alaas lakes are closely connected to climate change, permafrost thawing, catchment conditions, and land use. To reconstruct lake development throughout the Holocene we analyze sedimentary ancient DNA (sedaDNA) and biogeochemistry from a sediment core from Lake Satagay, spanning the last c. 10,800 calibrated years before present (cal yrs BP). SedaDNA of diatoms and macrophytes and microfossil diatom analysis reveal lake formation earlier than 10,700 cal yrs BP. The sedaDNA approach detected 42 amplicon sequence variants (ASVs) of diatom taxa, one ASV of Eustigmatophyceae (Nannochloropsis), and 12 ASVs of macrophytes. We relate diatom and macrophyte community changes to climate-driven shifts in water level and mineral and organic input, which result in variable water conductivity, in-lake productivity, and sediment deposition. We detect a higher lake level and water conductivity in the Early Holocene (c. 10,700–7000 cal yrs BP) compared to other periods, supported by the dominance of Stephanodiscus sp. and Stuckenia pectinata. Further climate warming towards the Mid-Holocene (7000–4700 cal yrs BP) led to a shallowing of Lake Satagay, an increase of the submerged macrophyte Ceratophyllum, and a decline of planktonic diatoms. In the Late Holocene (c. 4700 cal yrs BP–present) stable shallow water conditions are confirmed by small fragilarioid and staurosiroid diatoms dominating the lake. Lake Satagay has not yet reached the final stage of alaas development, but satellite imagery shows an intensification of anthropogenic land use, which in combination with future warming will likely result in a rapid desiccation of the lake.</p>

opencc-zeroJul 2022View details →
dryad40/100

Data for: Sedimentary ancient DNA and pollen reveal the composition of plant organic matter in Late Quaternary permafrost sediments of the Buor Khaya Peninsula (north-eastern Siberia)

Open the record for dataset details and reuse information.

publicSep 2020View details →
dryad40/100

Permafrost-thaw lake development in Central Yakutia: sedimentary ancient DNA and element analyses from a Holocene sediment record

Open the record for dataset details and reuse information.

publicJul 2022View details →
dryad36/100

Data from: The history of tree and shrub taxa on Bol'shoy Lyakhovsky Island (New Siberian Archipelago) since the last interglacial uncovered by sedimentary ancient DNA and pollen data

<p>Ecosystem boundaries, such as the Arctic-Boreal treeline, are strongly coupled with climate and were spatially highly dynamic during past glacial-interglacial cycles. Only a few studies cover vegetation changes since the last interglacial, as most of the former landscapes are inundated and difficult to access. Using pollen analysis and sedimentary ancient DNA (<span class="html-italic">s</span>edaDNA) metabarcoding, we reveal vegetation changes on Bol'shoy Lyakhovsky Island since the last interglacial from permafrost sediments. Last interglacial samples depict high levels of floral diversity with the presence of trees (<em><span class="html-italic">Larix</span></em>,<span class="html-italic"> <em>Picea</em></span>,<span class="html-italic"> <em>Populus</em></span>) and shrubs (<em><span class="html-italic">Alnus</span></em>, <em><span class="html-italic">Betula</span></em>, <em><span class="html-italic">Ribes</span></em>, <span class="html-italic"><em>Cornus</em>, </span>Saliceae) on the currently treeless island. After the Last Glacial Maximum, <em><span class="html-italic">Larix</span> </em>re-colonised the island but disappeared along with most shrub taxa. This was probably caused by Holocene sea-level rise, which led to increased oceanic conditions on the island. Additionally, we applied two newly developed larch-specific chloroplast markers to evaluate their potential for tracking past population dynamics from environmental samples. The novel markers were successfully re-sequenced and exhibited two variants of each marker in last interglacial samples. SedaDNA can track vegetation changes as well as genetic changes across geographic space through time and can improve our understanding of past processes that shape modern patterns.</p>

opencc-zeroSep 2020View details →
dryad36/100

Phylogenetic diversity and environment form assembly rules for Arctic diatom genera – a study on recent and ancient sedimentary DNA

<p><span><b>Aim</b></span></p> <p><span>This study investigates taxonomic and phylogenetic diversity in diatom genera to evaluate assembly rules for eukaryotic microbes across the Siberian treeline. We first analysed how phylogenetic distance relates to taxonomic richness and turnover. Second, we used relatedness indices to evaluate if environmental filtering or competition influences the assemblies in space and through time. Third, we used distance-based ordination to test which environmental variables shape diatom turnover.</span></p> <p><span><b>Location</b></span></p> <p><span>Yakutia and Taymyria, Russia: we sampled 78 surface sediments and a sediment core, extending to 7000 years before present, to capture the forest–tundra transition in space and time, respectively. </span></p> <p><span><b>Taxon</b></span></p> <p><span>Arctic freshwater diatoms.</span></p> <p><span><b>Methods</b></span></p> <p><span>We applied metabarcoding to retrieve diatom diversity from surface and core sedimentary DNA. The taxonomic assignment binned sequence types (lineages) into genera and created taxonomic (abundance of lineages within different genera) and phylogenetic datasets (phylogenetic distances of lineages within different genera).</span></p> <p><span><b>Results</b></span></p> <p><span>Contrary to our expectations, we find a unimodal relationship between phylogenetic distance and richness in diatom genera. We discern a positive relationship between phylogenetic distance and taxonomic turnover in spatially and temporally distributed diatom genera. Further, we reveal positive relatedness indices in diatom genera across the spatial environmental gradient and predominantly in time-slices at a single location, with very few exceptions assuming effects of competition. Distance-based ordination of taxonomic and phylogenetic turnover indicates that lake environment variables, like HCO<sub>3</sub><sup>–</sup> and water depth, largely explain diatom turnover. </span></p> <p><span><b>Main conclusion</b></span></p> <p>Phylogenetic and abiotic assembly rules are important in understanding the regional assembly of diatom genera across lakes in the Siberian treeline ecotone. Using a space–time approach we are able to exclude the influence of geography and elucidate that lake environmental variables primarily shape the assemblies. We conclude that some diatom genera have greater capabilities to adapt to environmental changes, whereas others will be putatively replaced or lost due to the displacement of the Arctic tundra biome under recent global warming.</p>

opencc-zeroDec 2020View details →
zenodo36/100

Marine Sedimentary Ancient DNA (sedaDNA) from the North Atlantic Ocean

<p>Filtered sedimentary ancient DNA data (megan files), that includes sequence counts per sample. Additionally, scripts for the correlation analysis and heatmap are included.&nbsp;</p>

opencc-by-4.0Nov 2021View details →
dryad36/100

High resolution ancient sedimentary DNA shows that alpine plant diversity is associated with human land use and climate change

<p>The European Alps are highly rich in species, but their future may be threatened by ongoing changes in human land use and climate. Here, we reconstructed vegetation, temperature, human impact and livestock over the past ~12,000 years from Lake Sulsseewli, based on sedimentary ancient plant and mammal DNA, pollen, spores, chironomids, and microcharcoal. We assembled a highly-complete local DNA reference library (PhyloAlps, 3,923 plant taxa), and used this to obtain an exceptionally rich <em>sed</em>aDNA record of 366 plant taxa. Vegetation mainly responded to climate during the early Holocene, while human activity had an additional influence on vegetation from 6 ka onwards. Land-use shifted from episodic grazing during the Neolithic and Bronze Age to agropastoralism in the Middle Ages. Associated human deforestation allowed the coexistence of plant species typically found at different elevational belts, leading to levels of plant richness that characterise the current high diversity of this region. Our findings indicate a positive association between low-intensity agropastoral activities and precipitation with the maintenance of the unique subalpine and alpine plant diversity of the European Alps.</p>

opencc-zeroSep 2022View details →
zenodo36/100

Inventory of ancient environmental DNA from sedimentary archives: locations, methods, and target taxa

<p>Locations of sampling sites from sedimentary ancient environmental DNA (aeDNA) studies. aeDNA is DNA that has degraded into short fragments, exhibits post-mortem damage signatures, and is recovered from a non-living tissue, organism, or environmental sample. Here we focus on sedimentary archives with contiguous records such as lake and marine sediments, permafrost, middens, cave sediments, soils, and incidental associated surface sediment samples used to interpret sedimentary archives. Studies span historic and ancient time periods using a variety of DNA-based methods (i.e., metabarcoding, shotgun sequencing, target capture, qPCR, ddPCR, and others) to study taxa from microorganisms to plants and mammals.</p>

opencc-by-4.0Jul 2022View details →
dryad36/100

Fungus and plant sedimentary ancient DNA metabarcoding data from five lakes in Siberia

Open the record for dataset details and reuse information.

publicOct 2025View details →
dryad36/100

High resolution ancient sedimentary DNA shows that alpine plant diversity is associated with human land use and climate change

Open the record for dataset details and reuse information.

publicSep 2022View details →
dryad36/100

Data from: The history of tree and shrub taxa on Bol'shoy Lyakhovsky Island (New Siberian Archipelago) since the last interglacial uncovered by sedimentary ancient DNA and pollen data

Open the record for dataset details and reuse information.

publicSep 2020View details →
dryad36/100

Millennia of metacommunity diversification and homogenization captured by sedimentary ancient DNA

Open the record for dataset details and reuse information.

publicSep 2025View details →
dryad36/100

Data from: Phylogenetic diversity and environment form assembly rules for Arctic diatom genera—a study on recent and ancient sedimentary DNA

Open the record for dataset details and reuse information.

publicApr 2020View details →
dryad32/100

Diatom sedimentary ancient DNA metabarcoding from western Fram Strait and Kronotsky Peninsula

<p>In this study we use sedimentary ancient DNA metabarcoding from two marine sediment cores. The first Kastenlot core MSM05/5-712-2 was taken at western Fram Strait (subarctic North Atlantic) from which we collected 12 samples including one biological replicate. The second Kastenlot core SO201-2-12KL was retrieved from Kamchatka Strait (subarctic North Pacific) from which we collected 9 samples and 2 samples were collected from a pilot core taken next to the Kastenlot core. Total DNA was extracted from approximately 2ml sediment per sample in 3 batches with up to 9 samples and one extraction blank. Total DNA was concentrated and if necessary diluted to 2.5 ng/µl. For each batch we performed PCRs in triplicates including a PCR no template control (NTC). We amplified a diatom-specific, 76 bp long part of the rbcL gene with tagged primers Diat_rbcL_705F (AACAGGTGAAGTTAAAGGTTCATAYTT) and Diat_rbcL_808R (TGTAACCCATAACTAAATCGATCAT). The PCR-products were purified and pooled in equal concentrations. The sequencing library was prepared with the Mid Output kit v. 2 according to the Fasteris Metafast protocol for low complexity amplicon sequencing and checked by qPCR. The library was sequenced (2 x 150 bp, paired-end) on the Illumina NextSeq 500 at the Fasteris SA sequencing service (Switzerland). For two samples we sequenced 4 PCR-products and for two samples we could only get 2 PCR-products with sufficient DNA content for sequencing.</p>

opencc-zeroAug 2020View details →
dryad32/100

Plant sedimentary ancient DNA data from Far East Russia

<p>Woody plants are expanding into the Arctic in response to the warming climate. The impact on arctic plants is not well understood due to the limited knowledge about plant assembly rules. Past plant diversity over long time series is rare. Here, we applied sedimentary ancient DNA metabarcoding targeting the P6 loop of the chloroplast <i>trnL</i> gene to a sediment record from Lake Ilirney (central Chukotka, Far Eastern Russia) covering the last 28 thousand years. Our results show that forb-rich steppe-tundra and dwarf-shrub tundra dominated during the cold climate before 14 ka, while deciduous erect-shrub tundra was abundant during the warm period since 14 ka. <i>Larix</i> invasion during the late Holocene substantially lagged behind the likely warmest period between 10 and 6 ka, where the vegetation coverage was densest. We reveal highest richness during 28–23 ka and a second richness peak during 13–10 ka, with both periods being accompanied by low shrub abundance. During the cold period before 14 ka, rich communities were phylogenetically clustered, suggesting low genetic divergence in the communities despite the great number of species. This probably originates from environmental filtering along with niche differentiation due to limited resources under harsh environmental conditions. In contrast, during the warmer period after 14 ka, rich communities were phylogenetically overdispersed. This results from a high number of species which were found to harbor high genetic divergence, likely originating from an erratic recruitment process in the course of warming. Some of our evidence may be of relevance for inferring future arctic plant assembly rules and diversity changes. By analogy to the past, we expect a lagged response of tree invasion. Plant richness may overshoot in the short term; in the long-term, however, the ongoing expansion of deciduous shrubs will eventually result in a phylogenetically more diverse community.</p>

opencc-zeroJan 2021View details →
dryad32/100

Data from: Islands in the ice: detecting past vegetation on Greenlandic nunataks using historical records and sedimentary ancient DNA meta-barcoding

Nunataks are isolated bedrocks protruding through ice sheets. They vary in age, but represent island environments in "oceans" of ice through which organism dispersals and replacements can be studied over time. The J.A.D. Jensen's Nunataks at the southern Greenland ice sheet are the most isolated nunataks on the northern hemisphere - some 30 km from the nearest biological source. They constitute around 2 km2 of ice-free land that was established in the early Holocene. We have investigated the changes in plant composition at these nunataks using both the results of surveys of the flora over the last 130 years, and through reconstruction of the vegetation from the end of the Holocene Thermal Maximum (5528±75 cal yr BP) using meta-barcoding of plant DNA recovered from the nunatak sediments (sedaDNA). Our results show that several of the plant species detected with sedaDNA are described from earlier vegetation surveys on the nunataks (in 1878, 1967 and 2009). In 1967, a much higher biodiversity was detected than from any other of the studied periods. While this may be related to differences in sampling efforts for the oldest period, it is not the case when comparing the 1967 and 2009 levels where the botanical survey was exhaustive. As no animals and humans are found on the nunataks, this change in diversity over a period of just 42 years must relate to environmental changes likely being climate-driven. This suggests that even the flora of fairly small and isolated ice-free areas reacts quickly to a changing climate.

opencc-zeroDec 2010View details →
dryad32/100

Data from: A comparative study of ancient sedimentary DNA, pollen and macrofossils from permafrost sediments of northern Siberia reveals long-term vegetational stability

Although ancient DNA from sediments (sedaDNA) has been used to investigate past ecosystems, the approach has never been directly compared to the traditional methods of pollen and macrofossil analysis. We conducted a comparative survey of 18 ancient permafrost samples spanning the Late Pleistocene (46–12.5 thousand years ago), from the Taymyr Peninsula in northern Siberia. The results show that pollen, macrofossils and sedaDNA are complementary rather than overlapping, and in combination reveal more detailed information on plant palaeocommunities than can be achieved by each individual approach. SedaDNA and macrofossils share greater overlap in plant identifications than with pollen, suggesting that sedaDNA is local in origin. These two proxies also permit identification to lower taxonomic levels than pollen, enabling investigation of temporal changes in species composition and the determination of indicator species to describe environmental changes. Combining data from all three proxies, reveals an area continually dominated by a mosaic vegetation of tundra-steppe, pioneer and wet-indicator plants. Such vegetational stability is unexpected, given the severe climate changes taking place in the northern hemisphere during this time, with changes in average annual temperatures of &gt; 22ºC. This may explain the abundance of ice-age mammals such as horse and bison in Taymyr Peninsula during the Pleistocene, and why it acted as a refugium for the last mainland woolly mammoth. Our finding reveals the benefits of combining sedaDNA, pollen and macrofossil for palaeovegetational reconstruction and add to the increasing evidence suggesting large areas of the northern hemisphere remained ecologically stable during the Late Pleistocene.

opencc-zeroDec 2010View details →
zenodo32/100

Sedimentary ancient DNA (sedaDNA) from Tramacastilla Lake (Central Pyrenees, Spain)

<p>Here is the data used in Juli&aacute;n-Posada et al., 2024 for sedaDNA analysis in a Pyrenean lacustrine sequence (Tramacastilla lake, 1682 m a.s.l.)</p>

opencc-by-4.0Jun 2024View details →
dryad32/100

Ancient sedimentary plant DNA dataset from Batagay (B17), Yakutia

<p>Here we provide a dataset on genetic plant diversity retrieved from permafrost sedimentary ancient DNA (sedaDNA) of the Batagay megaslump, Yakutia. Our dataset encompasses sedaDNA sequence data of 10 sediment samples. We used a PCR-based metabarcoding approach combined with Next-Generation Sequencing to assess the past, local vegetation compositional changes around the megaslump. As a plant specific metabarcode we applied the established chloroplastidal P6 loop trnL marker for plant diversity assessment. PCR products were sequenced on one Illumina sequencing HiSeq 2500 run.</p>

opencc-zeroJun 2022View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record