Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
35
datasets available to search
ShareScore release 0.7.1
Dataset results
35 results for “COI primers”
Fig. 5 in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification
Fig. 5 Percentage of template sequences coverage of the primer subsets analyzed on the second evaluation round. The red dashed line represents the complete coverage of the analyzed template sequences
Fig. 4 Primers binding position distributed along the 1,500 in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification
Fig. 4 Primers binding position distributed along the 1,500 bp of the avian COI gene. A Binding position of forward primers. B Binding position of reverse primers
Fig. 3 in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification
Fig. 3 Effect of the number of allowed primer-template mismatches on primer binding. Y-axis = number of primers with at least one binding event on every scenario of allowed mismatches (X-axis)
Fig. 1 Retrieved data distribution. A in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification
Fig. 1 Retrieved data distribution. A Distribution of published primers for the barcode region of the avian COI gene throughout the years. B Number of complete COI sequences available for each bird order
Fig. 2 in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification
Fig. 2 Variation on the number of primers bound to the template sequences of each bird order. The dots represent data outliers
Data from: A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents
Introduction: The PCR-based analysis of homologous genes has become one of the most powerful approaches for species detection and identification, particularly with the recent availability of Next Generation Sequencing platforms (NGS) making it possible to identify species composition from a broad range of environmental samples. Identifying species from these samples relies on the ability to match sequences with reference barcodes for taxonomic identification. Unfortunately, most studies of environmental samples have targeted ribosomal markers, despite the fact that the mitochondrial Cytochrome c Oxidase subunit I gene (COI) is by far the most widely available sequence region in public reference libraries. This is largely because the available versatile ("universal") COI primers target the 658 barcoding region, whose size is considered too large for many NGS applications. Moreover, traditional barcoding primers are known to be poorly conserved across some taxonomic groups. Results: We first design a new PCR primer within the highly variable mitochondrial COI region, the "mlCOIintF" primer. We then show that this newly designed forward primer combined with the "jgHCO2198" reverse primer to target a 313 bp fragment performs well across metazoan diversity, with higher success rates than versatile primer sets traditionally used for DNA barcoding (i.e. LCO1490/HCO2198). Finally, we demonstrate how the shorter COI fragment coupled with an efficient bioinformatics pipeline can be used to characterize species diversity from environmental samples by pyrosequencing. We examine the gut contents of three species of planktivorous and benthivorous coral reef fish (family: Apogonidae and Holocentridae). After the removal of dubious COI sequences, we obtained a total of 334 prey Operational Taxonomic Units (OTUs) belonging to 14 phyla from 16 fish guts. Of these, 52.5% matched a reference barcode (>98% sequence similarity) and an additional 32% could be assigned to a higher taxonomic level using Bayesian assignment. Conclusions: The molecular analysis of gut contents targeting the 313 COI fragment using the newly designed mlCOIintF primer in combination with the jgHCO2198 primer offers enormous promise for metazoan metabarcoding studies. We believe that this primer set will be a valuable asset for a range of applications from large-scale biodiversity assessments to food web studies.
Data from: Validation of COI metabarcoding primers for terrestrial arthropods
Open the record for dataset details and reuse information.
Data from: A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents
Open the record for dataset details and reuse information.
Supplementary material 4 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416
COI library ASV tax
Supplementary material 1 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416
File S1
Supplementary material 3 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416
16S library ASV tax
Supplementary material 5 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416
Unassigned COIASVs krona
Supplementary material 2 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416
Metadata all
COI sequences used in primer design
<p>COI sequences used for designing specific primers for <em>Garra cambodgiensis</em></p>
Figure 7 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 7 Scheme with overview of PCR attempts to recover the barcoding region of cytochrome c oxidase subunit I with novel primers from archival specimens from the genera Aphidius, Praon, Lysiphlebus, Ephedrus and Monoctonus. Primer pairs coloured red were used in direct PCR; black coloured primers were used in secondary nested reactions. Positions where short fragments within the subsequences overlap are marked with a pattern.
Figure 3 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 3 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Praon samples. Three direct PCR reactions were conducted with primer pairs: 1. LCO1490/Pr1Rd, 2. Pr2Fd/Pr2Rd, 3. Pr3Fd/HCO2198. The species included in trials are PF1- P. volucre, PF2- P. dorsale, PF3- P. abjectum; M – marker.
Figure 6 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 6 Agarose gel visualizing the products of nested trials with products of direct PCR for samples LD8 – L. confusus, LD9 – L. desertorum; LD12 – L. fabarum; and LD13 – L. alpinus. The products of LD8 and LD9 from PCR with LCO1490/Lys1Rd were submitted to secondary reactions combining two primer pairs, viz., 1. LCO1490/Lys1Rn; and 2. Lys1Fn/Lys1Rd. Amplicons of LD8, LD9 and LD12 obtained with Aph2Fd/Lys2Rd were submitted to secondary nested trials with primer pairs Aph2Fd/Lys2Rn and Lys2Fn/Lys2Rd. Products from direct PCR with Lys3Fd/HCO2198 were used as the template for nested reactions with Lys3Fd/Aph3Rn and Lys3Fn/HCO2198.
Figure 5 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 5 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Lysiphlebus samples. Tested combinations of primers were: 1) LCO1490/Lys1Rd; 2) Aph2Fd/Lys2Rd; 3) Pr2Fd/Lys2Rd; and 4) Lys3Fd/HCO2198. The species included in trials were: LF1 - L. hirticornis; LF2 - L. cardui; and LF3 - L. fabarum; M – marker.
Figure 4 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 4 Agarose gel visualizing the products of nested trials with products of direct PCR for samples PD12 - P. barbatum, PD14 - P. yomenae, and PD15 - P. yomenae. The products from PCR with Pr2Fd/Pr2Rd were submitted to secondary nested trials with primer pairs Pr2Fd/Pr2Rn and Aph2Fn/Pr2Rd. Amplicons obtained with Pr3Fd/HCO2198 were used as the template for nested reactions with Pr3Fd/Pr3Rn and Pr3Fn/HCO2198.
Figure 1 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399
Figure 1 Position of internal degenerative primers within the barcoding region of COI. Aphidius - specific primers: Aph1Fn, Aph1Rn, Aph1Rd, Aph2Fd, Aph2Fn, Aph2Rn, Aph2Rd, Aph3Fd, Aph3Fn and Aph3Rn; Lysiphlebus - specific primers: Lys1Fn, Lys1Rd, Lys2Fn, Lys2Rn, Lys2Rd, Lys3Fd and Lys3Fn; Praon - specific primers: Pr1Fn, Pr1Rn, Pr1Rd, Pr2Fd, Pr2Rn, Pr2Rd, Pr3Fd, Pr3Fn and Pr3Rn. Arrows refer to the direction of the primers, forward or reverse. The exact position of internal primers is designated in comparison to the first nucleotide of the forward LCO1490 primer sequence (5' GGTCAACAAATCATAAAGATATTGG 3').
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.