Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

35

datasets available to search

ShareScore release 0.7.1

Reset

Dataset results

35 results for “COI primers”

Learn how ShareScore rates datasets ↗
zenodo40/100

Fig. 5 in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification

Fig. 5 Percentage of template sequences coverage of the primer subsets analyzed on the second evaluation round. The red dashed line represents the complete coverage of the analyzed template sequences

opencc-by-4.0Aug 2021View details →
zenodo40/100

Fig. 4 Primers binding position distributed along the 1,500 in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification

Fig. 4 Primers binding position distributed along the 1,500 bp of the avian COI gene. A Binding position of forward primers. B Binding position of reverse primers

opencc-by-4.0Aug 2021View details →
zenodo40/100

Fig. 3 in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification

Fig. 3 Effect of the number of allowed primer-template mismatches on primer binding. Y-axis = number of primers with at least one binding event on every scenario of allowed mismatches (X-axis)

opencc-by-4.0Aug 2021View details →
zenodo40/100

Fig. 1 Retrieved data distribution. A in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification

Fig. 1 Retrieved data distribution. A Distribution of published primers for the barcode region of the avian COI gene throughout the years. B Number of complete COI sequences available for each bird order

opencc-by-4.0Aug 2021View details →
zenodo40/100

Fig. 2 in Same information, new applications: revisiting primers for the avian COI gene and improving DNA barcoding identification

Fig. 2 Variation on the number of primers bound to the template sequences of each bird order. The dots represent data outliers

opencc-by-4.0Aug 2021View details →
dryad32/100

Data from: A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents

Introduction: The PCR-based analysis of homologous genes has become one of the most powerful approaches for species detection and identification, particularly with the recent availability of Next Generation Sequencing platforms (NGS) making it possible to identify species composition from a broad range of environmental samples. Identifying species from these samples relies on the ability to match sequences with reference barcodes for taxonomic identification. Unfortunately, most studies of environmental samples have targeted ribosomal markers, despite the fact that the mitochondrial Cytochrome c Oxidase subunit I gene (COI) is by far the most widely available sequence region in public reference libraries. This is largely because the available versatile ("universal") COI primers target the 658 barcoding region, whose size is considered too large for many NGS applications. Moreover, traditional barcoding primers are known to be poorly conserved across some taxonomic groups. Results: We first design a new PCR primer within the highly variable mitochondrial COI region, the "mlCOIintF" primer. We then show that this newly designed forward primer combined with the "jgHCO2198" reverse primer to target a 313 bp fragment performs well across metazoan diversity, with higher success rates than versatile primer sets traditionally used for DNA barcoding (i.e. LCO1490/HCO2198). Finally, we demonstrate how the shorter COI fragment coupled with an efficient bioinformatics pipeline can be used to characterize species diversity from environmental samples by pyrosequencing. We examine the gut contents of three species of planktivorous and benthivorous coral reef fish (family: Apogonidae and Holocentridae). After the removal of dubious COI sequences, we obtained a total of 334 prey Operational Taxonomic Units (OTUs) belonging to 14 phyla from 16 fish guts. Of these, 52.5% matched a reference barcode (>98% sequence similarity) and an additional 32% could be assigned to a higher taxonomic level using Bayesian assignment. Conclusions: The molecular analysis of gut contents targeting the 313 COI fragment using the newly designed mlCOIintF primer in combination with the jgHCO2198 primer offers enormous promise for metazoan metabarcoding studies. We believe that this primer set will be a valuable asset for a range of applications from large-scale biodiversity assessments to food web studies.

opencc-zeroDec 2012View details →
dryad32/100

Data from: Validation of COI metabarcoding primers for terrestrial arthropods

Open the record for dataset details and reuse information.

publicDec 2019View details →
dryad32/100

Data from: A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents

Open the record for dataset details and reuse information.

publicJun 2013View details →
zenodo28/100

Supplementary material 4 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416

COI library ASV tax

opencc-zeroJun 2022View details →
zenodo28/100

Supplementary material 1 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416

File S1

opencc-zeroJun 2022View details →
zenodo28/100

Supplementary material 3 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416

16S library ASV tax

opencc-zeroJun 2022View details →
zenodo28/100

Supplementary material 5 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416

Unassigned COIASVs krona

opencc-zeroJun 2022View details →
zenodo28/100

Supplementary material 2 from: Hintikka S, Carlsson JE, Carlsson J (2022) The bacterial hitchhiker's guide to COI: Universal primer-based COI capture probes fail to exclude bacterial DNA, but 16S capture leaves metazoa behind. Metabarcoding and Metagenomics 6: e80416. https://doi.org/10.3897/mbmg.6.80416

Metadata all

opencc-zeroJun 2022View details →
zenodo28/100

COI sequences used in primer design

<p>COI sequences used for designing specific primers for&nbsp;<em>Garra cambodgiensis</em></p>

opencc-by-4.0Sep 2022View details →
zenodo28/100

Figure 7 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 7 Scheme with overview of PCR attempts to recover the barcoding region of cytochrome c oxidase subunit I with novel primers from archival specimens from the genera Aphidius, Praon, Lysiphlebus, Ephedrus and Monoctonus. Primer pairs coloured red were used in direct PCR; black coloured primers were used in secondary nested reactions. Positions where short fragments within the subsequences overlap are marked with a pattern.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 3 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 3 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Praon samples. Three direct PCR reactions were conducted with primer pairs: 1. LCO1490/Pr1Rd, 2. Pr2Fd/Pr2Rd, 3. Pr3Fd/HCO2198. The species included in trials are PF1- P. volucre, PF2- P. dorsale, PF3- P. abjectum; M – marker.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 6 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 6 Agarose gel visualizing the products of nested trials with products of direct PCR for samples LD8 – L. confusus, LD9 – L. desertorum; LD12 – L. fabarum; and LD13 – L. alpinus. The products of LD8 and LD9 from PCR with LCO1490/Lys1Rd were submitted to secondary reactions combining two primer pairs, viz., 1. LCO1490/Lys1Rn; and 2. Lys1Fn/Lys1Rd. Amplicons of LD8, LD9 and LD12 obtained with Aph2Fd/Lys2Rd were submitted to secondary nested trials with primer pairs Aph2Fd/Lys2Rn and Lys2Fn/Lys2Rd. Products from direct PCR with Lys3Fd/HCO2198 were used as the template for nested reactions with Lys3Fd/Aph3Rn and Lys3Fn/HCO2198.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 5 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 5 Agarose gel visualizing the products of direct PCR in initial trials testing the novel primers with fresh Lysiphlebus samples. Tested combinations of primers were: 1) LCO1490/Lys1Rd; 2) Aph2Fd/Lys2Rd; 3) Pr2Fd/Lys2Rd; and 4) Lys3Fd/HCO2198. The species included in trials were: LF1 - L. hirticornis; LF2 - L. cardui; and LF3 - L. fabarum; M – marker.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 4 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 4 Agarose gel visualizing the products of nested trials with products of direct PCR for samples PD12 - P. barbatum, PD14 - P. yomenae, and PD15 - P. yomenae. The products from PCR with Pr2Fd/Pr2Rd were submitted to secondary nested trials with primer pairs Pr2Fd/Pr2Rn and Aph2Fn/Pr2Rd. Amplicons obtained with Pr3Fd/HCO2198 were used as the template for nested reactions with Pr3Fd/Pr3Rn and Pr3Fn/HCO2198.

opencc-by-4.0Jul 2018View details →
zenodo28/100

Figure 1 from: Mitrović M, Tomanović Ž (2018) New internal primers targeting short fragments of the mitochondrial COI region for archival specimens from the subfamily Aphidiinae (Hymenoptera, Braconidae). Journal of Hymenoptera Research 64: 191-210. https://doi.org/10.3897/jhr.64.25399

Figure 1 Position of internal degenerative primers within the barcoding region of COI. Aphidius - specific primers: Aph1Fn, Aph1Rn, Aph1Rd, Aph2Fd, Aph2Fn, Aph2Rn, Aph2Rd, Aph3Fd, Aph3Fn and Aph3Rn; Lysiphlebus - specific primers: Lys1Fn, Lys1Rd, Lys2Fn, Lys2Rn, Lys2Rd, Lys3Fd and Lys3Fn; Praon - specific primers: Pr1Fn, Pr1Rn, Pr1Rd, Pr2Fd, Pr2Rn, Pr2Rd, Pr3Fd, Pr3Fn and Pr3Rn. Arrows refer to the direction of the primers, forward or reverse. The exact position of internal primers is designated in comparison to the first nucleotide of the forward LCO1490 primer sequence (5' GGTCAACAAATCATAAAGATATTGG 3').

opencc-by-4.0Jul 2018View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record