Find research datasets worth reusing

opencc-by-4.0Mar 2018View details →

Fig. 2. Relationships concentration x in Anesthesia of tambaqui Colossoma macropomum (Characiformes: Serrasalmidae) with the essential oils of Aniba rosaeodora and Aniba parviflora and their major compound, linalool

Fig. 2. Relationships concentration x anesthesia induction or recovery time in tambaqui, Colossoma macropomum, exposed to the linalools. a. synthetic linalool; light sedation: y=4.4+(4281/x), r2=0.716, deep sedation: y=-22.5+(12252/x), r2=0.773, deep anesthesia:y=15.3+(17878/x), r2=0.669, recovery: y=43.9+0.66x+0.0015x2, r2=0.712. b. linalool extracted from Aniba rosaeodora; deep sedation: y=29.0+(6010/x), r2=0.784, deep anesthesia: y=-151.3+(60541/x), r2=0.873. Light sedation and recovery: no significant relationship. y = time to reach stage or recovery (s) and x = concentration (µL L-1).

opencc-zeroDec 2004View details →

FIGURE 1. Notozothecium janauachensis n in Notozothecium janauachensis n. sp. (Monogenoidea: Dactylogyridae) from wild and cultured tambaqui, Colossoma macropomum (Teleostei: Characidae: Serrasalminae) in Brazil

FIGURE 1. Notozothecium janauachensis n. sp. 1. Composite illustration of adult, ventral view of specimen from the natural habitat. Scale bar 50 m.

Figure 6 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize

Figure 6. Regression Graph (linear model) for the variable coefficient: Apparent digestibility of crude protein for tambaqui fed diets with different particle size of corn (Ŷ = 72.2 – 1.21.X; (R2 = 52.0%; p= 0.0014)).

Figure 5 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize

Figure 5. Regression Graph (Quadratic Model) for the variable specific growth rate (TCE) after 68 days of experiment (Ŷ = 6.15 – 0.00279.X + 0.00000191.X2; (R2 = 53.7%; p= 0.0006)).

Figure 2 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize

Figure 2. Regression Graph (Model Quadratic) for variable weight gain in the 68 days of experiment (Ŷ = 61.3 – 0.0807.X + 0.0000574X2 (R2 = 58.5%; p= 0.0002)).

Figure 4 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize

Figure 4. Regression Graph (Quadratic Model) for variable Total feed consumption in the 68 days of experiment (Ŷ = 556.6 – 0.513.X + 0.000321.X2; (R2 = 65.6%; p<0.0001)).

Figure 3 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize

Figure 3. Regression Graph (Cubic Model) for apparent feed conversion variable after 68 days of experiment (Ŷ = 1.27 – 0.00284X + 0.00000783X2 – 0.00000000570X3; (R2 = 58.,1%; p= 0.0007)).

Figure 1 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize

Figure 1. Regression Graph (Model Quadratic) for variable weight final after 68 days of experiment (Ŷ = 72.3 – 0.809.X + 0.0000576X2; (R2 = 58.5%; p= 0.0002)).

Fig 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions

Fig 1: Relative gene expression in tambaqui juveniles farmed in two Brazilian regions: Northern (Balbina; BA) and Southeast (Brumado; BRU). Different letters represent statistical differences between populations. The graphs show expression of A) hif-1α (p = 0.137), B) hsp-70 (p = 0.465), C) mstn (p = 0.907), D) ube3a (p = 0.205), E) ras (p = 0.041), F) cry-1 (p = 0.001), G) per-1 (p = 0.001), H) ogt (p = 0.001) and I) acly (p = 0.025).

Fig 3 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions

Fig 3: IBR analyses of relative gene expression in Balbina (BA) and Brumado (BRU) populations. The IBR values are 42.7 (Balbina) and 6.79 (Brumado).

Fig 2 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions

Fig 2: Heatmap of relative expression in Balbina (BA) and Brumado (BRU) populations. The colour scale ranges from blue (low transcript levels) to red (high transcript levels).

opencc-by-4.0Dec 2022View details →

Figure 1 in Antimicrobial resistance profile of Aeromonas spp. isolated from asymptomatic Colossoma macropomum cultured in the Amazonas State, Brazil

Figure 1. Records of Aeromonas spp. isolated from tambaqui (Colossoma macropomum) by fish farms in the rainy season (bars with stripes) and the dry season (bars with dots).

opencc-by-4.0Dec 2022View details →

Development of a pressure shock protocol to induce triploidy in tambaqui Colossoma macropomum (Cuvier, 1816)

Dataset on triploidization, fertilization, larval survival and growth rates from trials used to develop a pressure shock protocol to induce triploidy in tambaqui Colossoma macropomum (Cuvier, 1816)

zenodo36/100

Table 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions

Table 1: Details of target genes (hif-1α, hsp70, ras, mstn, acly, per-1, cry-1, ube3a and ogt) and reference genes (β- tubulin and β- actin) primers.<table><tbody><tr><th>Gene</th><th>Length (bp)</th><th>R 2</th><th>Efficiency (%)</th><th>Primers sequence (5ʹ-3ʹ) forward/reverse</th></tr></tbody><tbody><tr><th>tubulin -F</th><td>20</td><td>0.99</td><td>109.5</td><td>GACGTGGTGCCCAAAGATGT</td></tr><tr><th>tubulin -R</th><td>18</td><td>TGGATGGTGCGCTTGGT</td></tr><tr><th>β- actin -F</th><td>21</td><td>0.99</td><td>100.5</td><td>GCTGTTTTCCCCTCCATTGTT</td></tr><tr><th>β- actin -R</th><td>19</td><td>TCCCATGCCAACCATCACT</td></tr><tr><th>hif-1α -F</th><td>20</td><td>0.99</td><td>105.2</td><td>CTTCTGAGCTCTGATGAGGC</td></tr><tr><th>hif-1α -R</th><td>20</td><td>GAAAGCACCATCAGGAAGCC</td></tr><tr><th>hsp-70 -F</th><td>20</td><td>0.99</td><td>100.9</td><td>GCAAGGAGAACAAGATCACC</td></tr><tr><th>hsp-70 -R</th><td>19</td><td>CACTCCGTTGCACTTGTCC</td></tr><tr><th>mstn -F</th><td>20</td><td>0.98</td><td>100.5</td><td>AATCCAAGCGAGGGAAAAGC</td></tr><tr><th>mstn -R</th><td>22</td><td>CCTCCATCACCTGAAAGGTCTT</td></tr><tr><th>ras -F</th><td>20</td><td>0.97</td><td>99.31</td><td>CCAGTACATGAGGACAGGAG</td></tr><tr><th>ras -R</th><td>20</td><td>CAAGCACCATTGGCACATCG</td></tr><tr><th>acly -F</th><td>19</td><td>0.99</td><td>100.7</td><td>ATCATCTCCCGCACTACAG</td></tr><tr><th>acly -R</th><td>19</td><td>TACCTCCAATCTCTCCCAG</td></tr><tr><th>ube3a -F</th><td>21</td><td>0.98</td><td>103.3</td><td>GCCATAAGCAAGCAGCACAAC</td></tr><tr><th>ube3a -R</th><td>19</td><td>CCAGTCAGTCCGCACATCG</td></tr><tr><th>per-1 -F</th><td>20</td><td>0.98</td><td>104.1</td><td>TGTTGAAGTTTGTGCCCCAG</td></tr><tr><th>per-1 -R</th><td>18</td><td>CAGTCCAGATGCTCCTCC</td></tr><tr><th>cry-1 -F</th><td>19</td><td>0.99</td><td>103.6</td><td>GTCCAACAGCCCTCAAACT</td></tr><tr><th>cry-1 -R</th><td>18</td><td>TACGCCAAGCACTCCAGA</td></tr><tr><th>ogt -F</th><td>19</td><td>0.99</td><td>104.1</td><td>CCTCCCTTTGCTGTGTTCC</td></tr><tr><th>ogt -R</th><td>20</td><td>TGTCTGCTTTCCGCTTTCGC</td></tr></tbody></table>

opencc-by-4.0Feb 2023View details →

zenodo36/100

Fig. 15. Colossoma macropomum, 295 in The non-native freshwater fishes of Hong Kong: diversity, distributions, and origins

Fig. 15. Colossoma macropomum, 295 mm SL, aquarium trade, photographed by Heok Hui Tan.

Fig. 5. Correlation between the fibers diameters and body weight from 300 in Morphological and morphometric analysis of skeletal muscle between male and female young adult Colossoma macropomum (Characiformes: Serrasalmidae)

Fig. 5. Correlation between the fibers diameters and body weight from 300 days old Colossoma macropomum. The fibers diameters are showed by class: circle (<20 µm), triangle (20 to 50 µm) and square (>50 µm).

Fig. 1 in Morphological and morphometric analysis of skeletal muscle between male and female young adult Colossoma macropomum (Characiformes: Serrasalmidae)

Fig. 1. Muscle tissue organization in Colossoma macropomum. A. Multinucleated fibers with peripheral nuclei (arrow). Longitudinal section. HE. (Bar = 25 μm). B. Nuclei located at the periphery of the muscle fiber (arrow). Transverse section. HE. (Bar = 50 μm). C. Fascicle organized in perimysium and endomysium. Transverse section. HE. (Bar = 100 μm). D. Connective tissue surrounding the endomysium (dotted arrow) and perimysium (black arrow). Transverse section. Masson trichrome. (Bar = 50 μm). E. Mobilization of cells in the muscle fiber insertion in connective tissue (black arrow), many nuclei are observed. Longitudinal section. HE. (Bar = 50 μm). F. Sarcomere with striations along the muscle fiber. Longitudinal section. HE. (Bar = 25 μm).

Fig. 4 in Morphological and morphometric analysis of skeletal muscle between male and female young adult Colossoma macropomum (Characiformes: Serrasalmidae)

Fig. 4. Frequency of muscle fibers from 300 days old Colossoma macropomum. Significant differences (*) represent the differences between the animal groups according to body weight, 165 to 300 g (black) and 976 to 1,250 g (gray) in each class by ANOVA one-way supplemented by Tukey's test (P<0.05).

Fig. 3. A in Morphological and morphometric analysis of skeletal muscle between male and female young adult Colossoma macropomum (Characiformes: Serrasalmidae)

Fig. 3. A. Cellular apoptosis (black arrow). Transverse section. Masson trichrome. (Bar = 25 μm). B. Detail of the nerve (black circle). Transverse section. Masson trichrome. (Bar = 50 μm).