Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
29
datasets available to search
ShareScore release 0.7.1
Dataset results
29 results for “Detection probability”
Detection Probability of Red Wood Ants in Friedenweiler, Germany 2015
Estimation of population sizes and species ranges is central to population and conservation biology. It is widely appreciated that imperfect detection of mobile animals must be accounted for when estimating population size from presence-absence data. Sessile organisms also are imperfectly detected, but correction for detection probability in estimating their population sizes is rare. We illustrate challenges of detection probability and population estimation of sessile organisms using censuses of red wood ant (Formica rufa-group) nests as a case study. These ants, widespread in the northern hemisphere, can make large (up to 2m tall), highly visible nests. Using data from a two-day mapping campaign by eight individuals of 147 ant nests spread across sixteen 3600-m2 plots in the Black Forest region of southwest Germany, we developed a Bayesian model for quantifying detection probability of sessile organisms. Detection probabilities by individual observers of red wood ant nests ranged from 0.31 – 0.56, and depended on experience of the observers, size and density of nests, and habitat characteristics. Robust estimation of population density of sessile organisms—even highly apparent ones such as red wood ant nests—requires unbiased estimation of detection probability, just as it does when estimating population density of rare or cryptic species.
Probability of Detection applied to X-ray inspection using numerical simulations
<p>In this work, we apply and adapt established Probability of Detection (POD) methods on inline inspection of aluminium cylinder heads using X-ray computed tomography. The CT simulation tool SimCT [4] is used to acquire virtual images of the specimens including artificial defects, which avoids the manufacturing of calibrated defects of known type (e.g., pore, inclusion, crack etc.), size and location. One of the exemplary defects is discussed as representative result together with the generated POD curves as well as its characteristics (i.e., the minimum detected defect, the maximum missed defect, POD(a90) =0.90 and a90/95).</p>
Data associated to the paper "Phase diagram detection via Gaussian fitting of number probability distribution"
<p>We investigate the number probability density function that characterizes subportions of a quantum many-body system with globally conserved number of particles. We put forward a linear fitting protocol capable of mapping out the ground-state phase diagram of the rich one-dimensional extended Bose-Hubbard model: The results are quantitatively comparable with more sophisticated traditional and machine learning techniques. We argue that the studied quantity should be considered among the most informative bipartite properties, being moreover readily accessible in atomic gases experiments.<br><br>The dataset contains the entanglement spectra of several configurations of the extended Bose-Hubbard model ground state for different systems' sizes. </p>
Figure 2 in Assessing grass carp (Ctenopharyngodon idella) occupancy and detection probability within Lake Erie from environmental DNA
Figure 2. Mean posterior estimates of the probability of capturing grass carp eDNA from a site in a sample among sites (θ) from the model with the lowest WAIC score [ψ(Site)Θ(Site)p(.)]. Error bars represent 95% credible intervals. DR = Detroit River, HP = Hot Ponds, MB = Maumee Bay. All sites are located in western Lake Erie.
Figure 1 in Assessing grass carp (Ctenopharyngodon idella) occupancy and detection probability within Lake Erie from environmental DNA
Figure 1. Map denoting all monthly grass carp eDNA sampling events in 2018 (A–C) and 2019 (D–F) aggregated at each sampling location (Hot Ponds, Detroit River, and North Maumee Bay) and acoustic receiver locations (grey circles) in the western basin of Lake Erie. Positive and negative eDNA detections, defined as at least one positive qPCR detection on one replicate among all markers (GCTM10, GCTM22, GCTM32) are denoted by orange crosses and pink triangles, respectively. The 3 grass carp captured from conventional gear (total sampling events = 451) in the Detroit River (October 2018), Hot Pond (July 2019) and North Maumee Bay (July 2019) are denoted by a yellow hexagon.
Data from: Maximizing the detection probabilities of dusky grouse for population monitoring
Open the record for dataset details and reuse information.
Data from: The stochastic dynamics of early epidemics: probability of establishment, initial growth rate, and infection cluster size at first detection
<p>Emerging epidemics and local infection clusters are initially prone to stochastic effects that can substantially impact the epidemic trajectory. While numerous studies are devoted to the deterministic regime of an established epidemic, mathematical descriptions of the initial phase of epidemic growth are comparatively rarer. Here, we review existing mathematical results on the epidemic size over time, and derive new results to elucidate the early dynamics of an infection cluster started by a single infected individual. We show that the initial growth of epidemics that eventually take off is accelerated by stochasticity. These results are critical to improve early cluster detection and control. As an application, we compute the distribution of the first detection time of an infected individual in an infection cluster depending on the testing effort, and estimate that the SARS-CoV-2 variant of concern Alpha detected in September 2020 first appeared in the United Kingdom early August 2020. We also compute a minimal testing frequency to detect clusters before they exceed a given threshold size. These results improve our theoretical understanding of early epidemics and will be useful for the study and control of local infectious disease clusters.</p>
Table 1 in Assessing grass carp (Ctenopharyngodon idella) occupancy and detection probability within Lake Erie from environmental DNA
<p><b>Table 1.</b> Number of field samples (including controls) for each qPCR assay at each site sampled for eDNA in 2018 and 2019 in western Lake Erie. DR = Detroit River, HP = Hot Ponds, MB = Maumee Bay. Note that samples are site-specific.</p><table><tbody><tr><th>Site</th><th>Year</th></tr><tr><th>2018</th><th>2019</th></tr><tr><th>Assay</th><th>Samples</th><th>Assay</th><th>Samples</th></tr></tbody><tbody><tr><th>DR</th><td>GCTM10 GCTM22 GCTM32</td><td>78 78 78</td><td>GCTM10 GCTM22 GCTM32</td><td>81 81 81</td></tr><tr><th>HP</th><td>GCTM10 GCTM22 GCTM32</td><td>77 77 77</td><td>GCTM10 GCTM22 GCTM32</td><td>82 82 82</td></tr><tr><th>MB</th><td>GCTM10 GCTM22 GCTM32</td><td>78 78 78</td><td>GCTM10 GCTM22 GCTM32</td><td>80 80 80</td></tr></tbody></table>
Table 4 in Assessing grass carp (Ctenopharyngodon idella) occupancy and detection probability within Lake Erie from environmental DNA
<p><b>Table 4.</b> Percentage of positive eDNA replicate detections in each month and site in 2018 and 2019 in western Lake Erie (based on at least one positive detection on at least one marker and one replicate). All markers (GCTM10, GCTM 22, GCTM32) were used to calculate these proportions. Samples were collected monthly from June to November for each site. The number of telemetered grass carp detected within 7 days before sampling for eDNA is denoted in parentheses. Acoustic telemetry receivers in MB in 2018 were not available. DR = Detroit River, HP = Hot Ponds, and MB = Maumee Bay. NA denotes when acoustic telemetry receivers were not in operation.</p><table><tbody><tr><th>Year</th></tr><tr><th>Site</th><th>2018</th><th>2019</th></tr><tr><th></th><th>June</th><th>July</th><th>Aug</th><th>Sept</th><th>Oct</th><th>Nov</th><th>May</th><th>June</th><th>July</th><th>August</th><th>Oct</th><th>Nov</th></tr></tbody><tbody><tr><th>DR</th><td>0.0%</td><td>2.3%</td><td>2.3%</td><td>0.0%</td><td>0.0%</td><td>0.0%</td><td>4.5%</td><td>10.6</td><td>14.1</td><td>17.4%</td><td>14.1%</td><td>2.2%</td></tr><tr><td>(1)</td><td>(1)</td><td>(2)</td><td>(1)</td><td>(2)</td><td>(0)</td><td>(1)</td><td>% (1)</td><td>% (1)</td><td>(2)</td><td>(2)</td><td>(0)</td></tr><tr><th>HP</th><td>0.0%</td><td>0.1%</td><td>4.1%</td><td>2.2%</td><td>15.8%</td><td>0.0%</td><td>9.0%</td><td>1.5%</td><td>34.8</td><td>1.5%</td><td>15.8%</td><td>22.7%</td></tr><tr><td>(1)</td><td>(1)</td><td>(2)</td><td>(2)</td><td>(3)</td><td>(NA)</td><td>(2)</td><td>(2)</td><td>% (2)</td><td>(3)</td><td>(2)</td><td>(2)</td></tr><tr><th>MB</th><td>12.0%</td><td>0.0%</td><td>0.0%</td><td>0.0%</td><td>0.0%</td><td>0.0%</td><td>0.0%</td><td>6.1%</td><td>37.1</td><td>8.3%</td><td>8.3%</td><td>0.0%</td></tr><tr><td>(NA)</td><td>(NA)</td><td>(NA)</td><td>(NA)</td><td>(NA)</td><td>(NA)</td><td>(0)</td><td>(0)</td><td>% (0)</td><td>(0)</td><td>(0)</td><td>(0)</td></tr></tbody></table>
Table 3 in Assessing grass carp (Ctenopharyngodon idella) occupancy and detection probability within Lake Erie from environmental DNA
<p><b>Table 3.</b> Candidate set of hierarchical occupancy models used to estimate probability of grass carp eDNA occurrence among sites (ψ), the conditional probability of grass carp eDNA occurrence at a sampling locality within a site given that grass carp were present at the site (Θ), and the conditional probability of eDNA detection on replicate filters collected at a sampling locality given that the species is present at the sampling locality <i>(p</i>) from three sites in western Lake Erie sampled in 2018 and 2019. Covariates included location (site), time (Month) and probe type (GCTM10, GCTM22, GCTM32). Model comparison was evaluated with the Widely Applicable Information Criterion (WAIC).</p><table><tbody><tr><th>Model</th><th>WAIC</th><th>Δ WAIC</th><th>Lack of fit</th><th>Predicted Variance</th></tr></tbody><tbody><tr><th>ψ(Site)Θ(Site)p(.)</th><td>309.44</td><td>-</td><td>298.70</td><td>18.63</td></tr><tr><th>ψ(.)Θ(Site)p(.)</th><td>309.50</td><td>0.06</td><td>298.99</td><td>10.73</td></tr><tr><th>ψ(.)Θ(Month)p(.)</th><td>317.61</td><td>8.18</td><td>299.05</td><td>18.56</td></tr><tr><th>ψ(Season)Θ(.)p(.)</th><td>317.67</td><td>8.24</td><td>299.01</td><td>18.65</td></tr><tr><th>ψ(Month)Θ(.)p(.)</th><td>317.72</td><td>8.28</td><td>299.04</td><td>18.67</td></tr><tr><th>ψ(Season)Θ(Season)p(.)</th><td>317.84</td><td>8.40</td><td>299.04</td><td>18.79</td></tr><tr><th>ψ(.)Θ(Season)p(.)</th><td>317.74</td><td>8.31</td><td>299.07</td><td>18.66</td></tr><tr><th>ψ(Site)Θ(.)p(.)</th><td>317.94</td><td>8.51</td><td>299.04</td><td>18.90</td></tr><tr><th>ψ(.)Θ(.)p(.)</th><td>325.00</td><td>15.57</td><td>305.50</td><td>20.21</td></tr><tr><th>ψ(Season)Θ(Site)p(.)</th><td>325.41</td><td>15.98</td><td>305.49</td><td>19.91</td></tr><tr><th>ψ(Site + Season)Θ(.)p(.)</th><td>325.59</td><td>16.16</td><td>305.44</td><td>20.15</td></tr><tr><th>ψ(Site)Θ(Season)p(.)</th><td>325.72</td><td>16.29</td><td>305.48</td><td>20.23</td></tr><tr><th>ψ(Site + Season)Θ(Site + Season)p(.)</th><td>325.92</td><td>16.49</td><td>305.49</td><td>20.43</td></tr><tr><th>ψ(.)Θ(Site + Season)p(.)</th><td>326.37</td><td>16.94</td><td>305.52</td><td>20.84</td></tr><tr><th>ψ(Site)Θ(Month)p(.)</th><td>329.57</td><td>20.14</td><td>308.65</td><td>20.92</td></tr><tr><th>ψ(Month)Θ(Month)p(.)</th><td>330.14</td><td>20.71</td><td>308.66</td><td>21.84</td></tr><tr><th>ψ(Site + Season)Θ(Site)p(Probe)</th><td>377.63</td><td>68.20</td><td>276.90</td><td>100.72</td></tr><tr><th>ψ(Site + Season)Θ(.)p(Probe)</th><td>378.35</td><td>68.92</td><td>277.00</td><td>101.34</td></tr><tr><th>ψ(Site + Season)Θ(Site + Season)p(Probe)</th><td>378.42</td><td>68.99</td><td>277.00</td><td>101.41</td></tr><tr><th>ψ(Site + Season)Θ(Season)p(Probe)</th><td>378.55</td><td>69.12</td><td>277.09</td><td>101.46</td></tr><tr><th>ψ(Season)Θ(Site + Season)p(Probe)</th><td>379.41</td><td>69.98</td><td>277.28</td><td>102.10</td></tr><tr><th>ψ(Site)Θ(Site + Season)p(Probe)</th><td>379.62</td><td>70.19</td><td>277.40</td><td>102.21</td></tr><tr><th>ψ(.)Θ(Site + Season)p(Probe)</th><td>379.88</td><td>70.45</td><td>277.31</td><td>102.57</td></tr><tr><th>ψ(Site + Month)Θ(.)p(.)</th><td>383.56</td><td>74.13</td><td>282.86</td><td>100.69</td></tr><tr><th>ψ(Site + Month)Θ(Site + Month)p(.)</th><td>385.47</td><td>76.04</td><td>283.38</td><td>102.09</td></tr><tr><th>ψ(Site + Month)Θ(Site + Month)p(Probe)</th><td>386.95</td><td>77.52</td><td>282.90</td><td>104.05</td></tr><tr><th>ψ(.)Θ(Site + Month)p(.)</th><td>396.44</td><td>87.01</td><td>292.14</td><td>104.29</td></tr><tr><th>ψ(.)Θ(.)p(Probe)</th><td>396.45</td><td>87.01</td><td>292.14</td><td>104.29</td></tr></tbody></table>
Table 2 in Assessing grass carp (Ctenopharyngodon idella) occupancy and detection probability within Lake Erie from environmental DNA
<p><b>Table 2.</b> Gene region, primer, and probe sequences used to amplify GCTM10,GCTM22, and GCTM32 for grass carp.</p><table><tbody><tr><th>Gene</th><th>Primers and Probes</th><th>Sequence</th></tr></tbody><tbody><tr><th>ND2</th><td>Forward</td><td>5′- CCYTACGTACTCGCAATTCTAC -3′</td></tr><tr><th>ND2</th><td>Reverse</td><td>5′- GTGGTGGTGTTGGGCTATTA -3′</td></tr><tr><th>ND2</th><td>Probe</td><td>5′- VIC- ACCCTAACCTTTGCTAGCTCCCAC -MGBNFQ-3′</td></tr><tr><th>COII</th><td>Forward</td><td>5′- CCGACTCCTAGAAACAGATCAC -3′</td></tr><tr><th>COII</th><td>Reverse</td><td>5′- GGGACAGCTCAGGAATGTAATA -3′</td></tr><tr><th>COII</th><td>Probe</td><td>5′- 56-FAM- CCAGTTCGT/ZEN/GTCCTAGTATCTGCCGA -3IABkFQ -3′</td></tr><tr><th>COIII</th><td>Forward</td><td>5′- CCACGGACTACACGTCATTATT -3′</td></tr><tr><th>COIII</th><td>Reverse</td><td>5′-GATGTTCGGATGTAAAGTGGTATTG -3′</td></tr><tr><th>COIII</th><td>Probe</td><td>5′-NED- TTCCTAGCTGTTTGCCTTCTCCGT -MGBNFQ-3′</td></tr></tbody></table>
Multi-species occupancy model for estimating the probability of detecting amphibian species in Hungary
Open the record for dataset details and reuse information.
Data from: The stochastic dynamics of early epidemics: probability of establishment, initial growth rate, and infection cluster size at first detection
Open the record for dataset details and reuse information.
Maximizing detection probability to optimize nocturnal bird surveys in large areas
Open the record for dataset details and reuse information.
Assessing factors associated with detection probability of the Japanese burrowing cricket (Velarifictorus micado) on point count surveys
Open the record for dataset details and reuse information.
Occupancy and detection probability of American Three-toed Woodpecker in a heavily-managed boreal forest of eastern Canada
<p>The southern extent of the boreal forest in North America has experienced intensive human disturbance in recent decades. Among these, forest harvesting leads to the substantial loss of late-successional stands that include key habitat attributes for several avian species. The American Three-toed Woodpecker, <em>Picoides dorsalis</em>, is associated with continuous old spruce forests in the eastern part of its range. In this study, we assessed the influence of habitat characteristics at different scales on the occupancy of American Three-toed Woodpecker in a heavily-managed boreal landscape of northeastern Canada, and we inferred species occupancy at the regional scale. We conducted 185<br> playback stations over two breeding seasons and modelled the occupancy of the species while taking into account the probability of detection. American Three-toed Woodpecker occupancy was lower in stands with large areas recently clear-cut, and higher in landscapes with large extents of old-growth forest dominated by black spruce. At the regional scale, areas with high probability of occupancy were scarce and mostly within protected areas. Habitat requirements of the American Three-toed Woodpecker during the breeding season, coupled with overall low occupancy rate in our study area, challenge its long-term sustainability in such heavily managed landscapes. Additionally, the scarcity of areas of high probability of occupancy in the region suggests that the ecological role of old forest outside protected areas could be compromised.</p>
FIGURE. Phylogenetic tree of specimens on Poaceae and related host plants constructed by MP method based on ITS+28S regions of rDNA. Bootstrap values of MP and ML are followed by the Bayesian posterior probabilities (Bpp) on the nodes in the topology. Asterisk (*) represents bootstrap values or Bpp less than 50% in the topology. Sample data are shown with voucher specimen number or GenBank accession number, and host plant. Sequence data determined in this study are shown in color. Teliospore shapes are shown in each clade detected, and new species are shown by asterisk (*) on clades. 0, I: Spermogonial and aecial host genus. Asterisk (*) on host plants: Spermogonial and aecial host plants. in Phylogenetic approach for identification and life cycles of Puccinia (Pucciniaceae) species on Poaceae from northeastern China
FIGURE. Phylogenetic tree of specimens on Poaceae and related host plants constructed by MP method based on ITS+28S regions of rDNA. Bootstrap values of MP and ML are followed by the Bayesian posterior probabilities (Bpp) on the nodes in the topology. Asterisk (*) represents bootstrap values or Bpp less than 50% in the topology. Sample data are shown with voucher specimen number or GenBank accession number, and host plant. Sequence data determined in this study are shown in color. Teliospore shapes are shown in each clade detected, and new species are shown by asterisk (*) on clades. 0, I: Spermogonial and aecial host genus. Asterisk (*) on host plants: Spermogonial and aecial host plants.
Calculations for: Detector dog work assessing probability of detection for Yellow crazy ant
<p class="MsoNormal">The use of detector dogs within environmental programs has increased greatly over the past few decades, yet their<span> </span><span>search methods are not standardised, and variation in dog performance remains not well quantified or understood. There is much science to be done to improve the general utility of detector dogs, especially for invertebrate surveys.</span></p> <p class="MsoNormal">We report research for detector dog work conducted as part of yellow crazy ant eradication. One dog was first used to quantify probability of detection (POD) within a strictly controlled trial. We then investigated the search patterns of two dogs when worked through sites using different transect spacings. Specifically we quantified their presence within set distances of all locations in each assessment area, as well as the time they took to assess each area. In a GIS we then calculated the relative percentage of the entire search area within six distance categories, and combined this information with the POD values to obtain a site-level POD.</p> <p class="MsoNormal">The calculated relationship between distance and POD was extremely strong (R<sup>2</sup> = 0.998), with POD being 86% at 2 m and 28% at 25 m. For site-level assessments conducted by the two dogs, both dogs achieved highest site-level POD when operated on the lowest transect spacing (15 m), with POD decreasing significantly as transect spacing increased. Both dogs had strong linear relationships between area assessed and time, with the area assessed being greater when the transects had greater spacing. The working style of the two dogs also resulted in significantly different assessment outcomes. In one hour one dog could assess approximately 9.2 ha with transects spaced 20m apart, and 6.8ha with transects spaced 15 m apart, whereas the second dog could only assess approximately 6.9 ha with transects spaced 20 m apart, and 4.9 ha with transects spaced 15 m apart.</p> <p class="MsoNormal">Our study provides insight into the ability of dogs to detect yellow crazy ants, and sets the basis for further science and protocol development for ant detection. With the lessons learnt from this work we then detail protocols for using detector dogs for ant eradication assessments.</p>
Data points from simulating the probability of detecting DMRs or Epimutations
<p>Data points from running script NewSim_10Iters.R provided under Zenodo object 10.5281/zenodo.1205728</p>
Detecting Probable Alzheimer's Disease From Speech Using Linguistical Analysis
ClinicalTrials.gov study NCT04041895. IPD Sharing: NO. Countries: 1. Publications: 8.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.