Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

302

datasets available to search

ShareScore release 0.9.0

Dataset results

302 results for “Fusarium”

Learn how ShareScore rates datasets ↗

zenodo48/100

Alpha-Galactosaminidase family GH114 protein from Fusarium solani: X-ray diffraction images

This submission includes h5-files with diffraction images recorded using the Dectris EIGER X 16M detector at the DIAMOND beamline I04. The model of the crystal structure and associated information can be found in the Protein Data Bank entry 9EP6. The model has P 31 2 1 symmetry and three molecules per asymmetric unit. This is a case of crystal pathology – partial disorder. There is electron density for the fourth molecule which could be modelled with occupancy 1/2 and would overlap with a symmetry-related molecule.

opencc-by-4.0Apr 2024View details →

zenodo44/100

Annotation of the the assembled genome of Fusarium oxysporum f. sp. albedinis strain 133, the causal agent of date palm dieback.

Annotation of the the assembled genome of Fusarium oxysporum f. sp. albedinis strain 133 (Khayi et al., 2020). Gene prediction and annotation were carried out using funnotate pipeline v1.8.1 (Stajich, 2020), which includes masking, ab initio gene-prediction training, using Augustus and Genmark, with the EST dataset reported to the Ganoderma mycocosm repository, gene prediction, and the assignment of functional annotation to protein-coding gene models.

opencc-by-4.0Jan 2022View details →

zenodo44/100

Genome Assembly of Fusarium avenaceum

Here, we present a complete genome assembly for Fusarium avenaceum and associated annotation using long-read sequencing generated from the Oxford Nanopore Technologies (ONT;London, UK) platform for both DNA and RNA obtained from fruit-sampled cultures.

opencc-by-4.0Sep 2022View details →

zenodo44/100

Fusarium associated with Banana - DArT-seq Cuban and Latin-American samples

Using genotyping-by-sequencing and whole genome comparisons, we investigated the genetic diversity across this suite of isolates and compared it with the genetic diversity in a global Fusarium panel.

opencc-by-4.0Dec 2022View details →

zenodo40/100

A versatile microfluidic platform measures hyphal interactions between Fusarium graminearum and Clonostachys rosea in real-time

Routinely, fungal-fungal interactions (FFIs) are studied on agar surfaces. However, this format restricts high-resolution dynamic imaging. To gain experimental access to FFIs at the hyphal level in real-time, we developed a microfluidic platform, a FFI device. This device utilises microchannel geometry to enhance the visibility of hyphal growth and provides control channels to allow comparisons between localised and systemic effects. We demonstrate its function by investigating the FFI between the biological control agent (BCA) Clonostachys rosea and the plant pathogen Fusarium graminearum. Microscope image analyses confirm the inhibitory effect of the necrotrophic BCA and we show that a loss of fluorescence in parasitised hyphae of GFP-tagged F. graminearum coincides with the detection of GFP in mycelium of C. rosea. The versatility of our device to operate under both water-saturated and nutrient-rich as well as dry and nutrient-deficient conditions, coupled with its spatio-temporal output, opens new opportunities to study relationships between fungi.

opencc-by-4.0Feb 2020View details →

zenodo40/100

Unveiling the substrate-dependent dynamics of mycotoxin production in Fusarium verticillioides using an OSMAC-metabolomics approach

UHPLC-HRMS raw data files from the article : "Unveiling the substrate-dependent dynamics of mycotoxin production in Fusarium verticillioides using an OSMAC-metabolomics approach"

opencc-by-4.0Apr 2024View details →

zenodo40/100

Figure 1 in Microorganisms from corn stigma with biocontrol potential of Fusarium verticillioides

Figure 1. Percentage of mycelial growth inhibition of Fusarium verticillioides by endophytic and epiphytic microorganisms from maize silks collected in different Brazilian regions.

opencc-by-4.0Dec 2022View details →

zenodo40/100

Fig. 1. Maximum Likelihood tree for genus Fusarium with TEF-1 in First report of seven unrecorded bambusicolous fungi in Korea

Fig. 1. Maximum Likelihood tree for genus Fusarium with TEF-1α + RPB2 combined dataset. Node numbers indicate bootstrap value above 70%. Blue colored names indicate the strains isolated in this study. Type strains are indicated by "T".

opencc-by-4.0Jan 2024View details →

zenodo40/100

Рис. 1. КоΛичество макрокониΑий грибов роΑа Fusarium (% от общего чисΛа эΛементов морфоΛогии) на органах и в физиоΛогических жиΑкостях картофеΛьной коровки Fig. 1. Number of macroconidia of fungus species from the genus Fusarium (% of the total number of morphological elements) on organs and in physiological fluids of the potato ladybird beetle in On the vector characteristics of the potato ladybird beetle Henosepilachna Vigintioctomaculata (Motsch.) (Coleoptera, Coccinellidae) in the system "phytophagous insect - plant pathogen - plant"

Рис. 1. КоΛичество макрокониΑий грибов роΑа Fusarium (% от общего чисΛа эΛементов морфоΛогии) на органах и в физиоΛогических жиΑкостях картофеΛьной коровки Fig. 1. Number of macroconidia of fungus species from the genus Fusarium (% of the total number of morphological elements) on organs and in physiological fluids of the potato ladybird beetle

opencc-by-4.0Jul 2024View details →

zenodo40/100

Identifying the Fusarium species involved in foot rot disease of beans in the UK using a combined molecular and microbiological approach

Materials and methods Fungal isolation Isolates (113) were prepared from both soil and infected plant samples that were received from the Plant Clinic at the Processors and Growers Research Organisation (PGRO). The samples were from different regions of England, United Kingdom (Table 1). <a name="_Ref165642771"></a>Table 1: The locations and number of isolates obtained for infected faba bean and soil samples used in the study. * = includes soil isolates <table> <tbody> <tr> <td> Location </td> <td> Number of isolates obtained </td> <td> Month(s) </td> </tr> <tr> <td> PGRO experimental plots </td> <td> 29* (13 soil, 16 plant) </td> <td> November 2022 </td> </tr> <tr> <td> Cambridgeshire </td> <td> 2 </td> <td> June 2023 </td> </tr> <tr> <td> Oxfordshire </td> <td> 3 </td> <td> June-July 2023 </td> </tr> <tr> <td> Durham </td> <td> 3 </td> <td> July 2023 </td> </tr> <tr> <td> Shropshire </td> <td> 4 </td> <td> July and August2023 </td> </tr> <tr> <td> Lincolnshire </td> <td> 5 </td> <td> July and August 2023 </td> </tr> <tr> <td> Northumberland </td> <td> 5 </td> <td> July and August 2023 </td> </tr> <tr> <td> Staffordshire </td> <td> 4 </td> <td> July  and August 2023 </td> </tr> <tr> <td> Suffolk </td> <td> 4 </td> <td> July 2023 </td> </tr> <tr> <td> Leicestershire </td> <td> 2 </td> <td> July 2023 </td> </tr> <tr> <td> Essex </td> <td> 4 </td> <td> July 2023 </td> </tr> <tr> <td> Norfolk </td> <td> 34 </td> <td> August 2023 </td> </tr> <tr> <td> Yorkshire </td> <td> 6 </td> <td> September 2023 </td> </tr> <tr> <td> Hampshire </td> <td> 2 </td> <td> July 2023 </td> </tr> <tr> <td> Undisclosed PGRO locations </td> <td> 6 </td> <td> Undisclosed </td> </tr> </tbody> </table>   Infected plant samples were disinfected by placing pieces of infected stems/root in 10 % sodium hypochlorite solution for 5 min. The samples were rinsed twice using sterilised distilled water and placed on sterilised filter paper to be dried for 10 min at room temperature inside a laminar flow hood. The dried samples were moved to potato dextrose agar medium (PDA) inside 9 cm diameter plastic Petri dishes. Petri dishes were incubated at 22<a name="_Hlk134433128"></a> °C with 12 h fluorescent photoperiod, <a name="_Hlk165887610"></a>and light intensity of 20-25 µMol.m-2.s-1. Once colonies had formed, clonal isolates were prepared from the colonies as follows. Approximately 1 mm2 of the colony was collected using a flame-sterilised inoculation loop and was sequentially spread onto three Petri dishes containing 2 % water agar, to dilute the inoculum gradually. The Petri dishes were incubated for 24 h as described above. The third Petri dish for each isolate was examined under a stereoscope, and one separated hypha was transferred using a flame-sterilised scalpel to another Petri dish containing PDA medium, and incubated for seven days to provide a clonal isolate. The isolates were stored for future use using two methods, for routine or long-term storage. For routine storage (months), three discs of the PDA medium containing the clonal isolate were transferred to a 2 ml microcentrifuge tube containing 1 ml of sterilised distilled water, the tube sealed with parafilm and stored at -20 °C. For long-term storage (3-4 years) the clonal isolate was plated onto a Petri dish containing many pieces of 1 cm long sterilised filter paper on PDA medium, and the colony was allowed to grow for seven days to cover the filter paper. The pieces of filter paper were removed and placed inside an empty Petri dish and dried for seven days at room temperature. The filter paper pieces were then transferred to an empty 2 ml plastic microcentrifuge tube and stored at -20 °C. Koch`s postulates were confirmed for each of the isolates by re-isolation, inoculation, and identification.   Pathogenicity testing Pathogenicity testing was conducted using susceptible faba bean seedlings (cv. Lynx) grown in test tubes in a mixture of perlite/vermiculite. The growth media was prepared by adding one volume of vermiculite (the capacity of a 1000 ml plastic beaker) to one volume of perlite inside an autoclave bag; this was mixed to ensure equal distribution of each component, and 1 litre of distilled water was added. The autoclave bag was closed and autoclaved for 20 min at 121 °C, and the mixture was transferred to fill 2/3 of the test tubes (150 x 24 mm, 1.2 ml wall; borosilicate glass 150 x 24 mm, rimless, Appleton Woods Ltd), which were then sealed with cotton wool and aluminium foil, prior to being autoclaved. Seeds were soaked in sterilized distilled water overnight and placed in 10 % sodium hypochlorite for 5 min. The seeds were washed three times with sterilised distilled water and placed on sterilised filter paper until dry. The seeds were then transferred to 9 cm petri dishes containing 1.2 % Tap Water Agar (12 g agar in 1 l of tap water, autoclaved in a 2 l conical flask), where they were allowed to germinate for four days in the incubator at 24 °C before being transferred to test tubes containing the vermiculite/perlite mixture. Following transfer, the seedlings were allowed to grow for five to seven days until they were suitable for inoculation (4-5 cm root length). The seedlings were inoculated by placing a 10 mm block of PDA medium containing a ten-day old fungal culture against the stem base. A small piece of sterilised cotton was placed around the stem to ensure adequate moisture at the inoculation site. The inoculated seedlings were incubated at 24 °C, with a 12 h photoperiod and light intensity of 20-25 µMol.m-2.s-1. Disease severity was monitored daily from 5-6 days after inoculation. Root and stem infection were scored on days 15 and 25 using a 5-point scale (Figure 2): 0 = healthy roots, no discolouration. 1 = up to 20 % root or stem base discoloured. 2 = 20-40 % root or stem base discoloured. 3 = 40-60 % root or stem base discoloured. 4 = 60-80 % root or stem base discoloured, stunting of plant. 5 = total discoloration, dead plant. DNA extraction Clonal colonies were cultured on 50 ml of Potato Dextrose Broth (PDB) medium (FORMEDIUMTM) in a 250 ml flask and incubated for seven days on a rotary shaker (22 °C with 70 RPM). The mycelium for each isolate was harvested by transferring the contents of each flask into a 50 ml falcon tube and centrifuging at 5000 RPM for 10 min. The supernatant was discarded, and the mycelium pellet stored at -20 °C. Mycelium (1 ml) was transferred to a 2 ml safe-lock microcentrifuge tube. The tubes were covered with parafilm which was pierced to allow moisture to evaporate. Samples were freeze-dried (-45 °C, 0.133 mbar) for 48 h. Freeze-dried mycelium (15 mg) was transferred to a 2 ml safe lock microcentrifuge tube containing two carbon steel ball bearings (3 mm diameter, grade 1000, SimplyBearings). The mycelium was homogenised for 4 min using a TissueLyser (Retsch MM400; 30 RPS), after which 120 µl of TNES buffer was added and the samples were homogenised again as before. Total DNA was extracted from the samples following the BOMB-Bio nucleic acid tissue DNA extraction protocol (Oberacker et al., 2019). The samples were incubated at 55 °C overnight after adding 2 µl of proteinase K and 3 µl of RNAase A. Following incubation, 240 µl of GITC lysis buffer was added, mixed and samples incubated at room temperature for 5 min. Isopropanol (480 µl) was added and, following centrifugation (5000 RPM; 5 min), 650 µl was transferred to a new tube with 200 µl of 1X BOMB-Bio magnetic bead solution (1:50 carboxylated SeraMag Speed Beads magnetic beads in TE) and mixed. The solution was placed on a magnetic rack to hold the beads with DNA bound to them in place whilst the supernatant was removed. The beads with bound DNA were washed once with isopropanol (400 µl) and twice with 80 % ethanol (400 µl). The solution was removed from the magnet, beads were allowed to dry briefly and 70 µl of nuclease free water was added to elute the DNA. The beads were removed by placing the samples back on the magnetic rack and transferring the supernatant to a new tube. The extracted DNA concentration was estimated using a Qubit 4 and 1X dsDNA High Sensitivity (HS) Assay Kit (Invitrogen) according to the manufacturer’s instructions. Polymerase Chain Reaction (PCR) DNA was amplified using PCR with three sets of primers: Internal Transcribed Spacer (ITS) primers ITS1/ITS4 (Raja et al., 2017) and two sets of Translation Elongation Factor one α primers, 1018F/1620R and EF1/EF2 (O’Donnell et al., 1998; Raja et al., 2017). Prior to PCR, the template DNA concentration was adjusted to<a name="_Hlk133674492"></a> 5 ng/μl using molecular grade water. The PCR mix <a name="_Hlk133674557"></a>contained: 12.5 µl of 2x MyTaq Red Mix (Meridian Bioscience), 3 µl of template DNA, 1 µl of each primer (10 µM) and 7.5 µl of nuclease free water to a final volume of 25 µl. The cycling conditions and sequence of each primer are given in Table 2. The PCR products were separated alongside a 1 kbp ladder (GeneRuler 1 kb Plus DNA Ladder Thermo scientific SM1331) using gel electrophoresis in a 1 % agarose gel in TAE buffer stained with GelRed® nucleic acid stain (Sigma Aldrich). Gels were visualised with a UV transilluminator (BioRad) to confirm successful amplification. <a name="_Ref162427061"></a>Table 2: The ITS (ITS1 and ITS4) and TEF1α (1018F, 1620R, EF1 and EF2) primer sequences and PCR conditions. <table> <tbody> <tr> <td> Primer </td> <td> Sequence (5’-3’) </td> <td> Initial Melt </td> <td> Melt </td> <td> Anneal </td> <td> Extension </td> <td> Final extension </td> </tr> <tr> <td> ITS1: ITS4:  (Raja et al., 2017) </td> <td> CGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC </td> <td> 94 °C 5 min </td> <td> 94°C 30 sec </td> <td> 55 °C 1 min </td> <td> 72 °C 2 min </td> <td> 72 °C 7 min </td> </tr> <tr> <td> 35 cycles </td> </tr> <tr> <td> 1018F: 1620R: (O’Donnell et al., 1998; Raja et al., 2017) </td> <td> GAYTTCATCAAGAACATGAT GACGTTGAADCCRACRTTGTC </td> <td> 94 °C 5 min   </td> <td> 94 °C 30 sec </td> <td> Touch down 66-56 °C 1 min   </td> <td> 72 °C 1 min </td> <td> 72 °C 10 min </td> </tr> <tr> <td> 9 cycles </td> </tr> <tr> <td> 94 °C 30 sec </td> <td> 56 °C 1 min   </td> <td> 72 °C 1 min </td> </tr> <tr> <td> Remaining 26 cycles </td> </tr> <tr> <td> EF1: EF2: (O’Donnell et al., 1998) (Raja et al., 2017) </td> <td> ATGGGTAAGGARGACAAGAC GGARGTACCAGT SATCATGTT   </td> <td> 95 °C 2 min </td> <td> 95 °C 30 sec </td> <td> 54.1 °C 1 min </td> <td> 72 °C 1 min </td> <td> 72 °C 5 min </td> </tr> <tr> <td> 35 cycles </td> </tr> <tr> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> </tr> </tbody> </table>   Prior to sequencing, the PCR products were purified using solid-phase reversible immobilisation (SPRI) magnetic beads. To each PCR product, 1 X SPRI beads were added at a 1:2 ratio of PCR product to bead solution (50 µl PCR product to 100 µl SPRI beads) and the mixture incubated for 5 min at room temperature. The tubes were transferred to the magnetic plate for 5 min until the solution was clear, at which point the supernatant was discarded and the beads were washed twice with 80% ethanol for 60 s each time. Ethanol was removed and the beads held on the magnetic plate were allowed to dry for 5-10 min at room temperature. The tubes containing the dry beads were removed from the magnetic plate, and 50 µl of molecular grade nuclease free water was added to each tube, mixed and incubated for 5 min, allowing the DNA to elute. The tubes were placed back on the magnetic plate for 5 min until the solution was clear, at which point the supernatant was transferred to a new 1.5 ml microcentrifuge tube. Sanger sequencing was carried out using ITS1, ITS4 primers and EF1, EF2 primers. All sequencing was carried out by Eurofins Genomics. Following sequencing, the chromatograms obtained were trimmed and analysed using Geneious Prime (version 2023.0.4). First, low-quality bases (e.g., overlapping peaks) were trimmed from each end and the sequence upstream from that site, including the primer sequence, was deleted. The forward and reverse sequence for each sample were assembled using the de novo assemble function in Geneious at the highest sensitivity to create a consensus sequence (highest threshold quality: 60%). A basic local alignment search tool (BLAST) search was carried out for the consensus sequences using the NCBI-NR database for the ITS sequences, and, for the TEF1α sequences, the data available on the Fusarium ID database (Torres-Cruz et al., 2022). All of the TEF1α consensus sequences from all samples were subsequently aligned with the available sequences on the Fusarium ID database (Geneious global alignment with free end gaps, 65% similarity), and a phylogenetic tree was generated (genetic distance model Tamura-Nei, neighbour joining method, bootstrap with 100 replicates).

opencc-by-4.0Oct 2024View details →

zenodo40/100

Extracellular vesicles from Fusarium graminearum contain protein effectors expressed during infection of corn

Fusarium graminearum (Fgr) is a devastating filamentous fungal pathogen that causes diseases in cereals, while producing mycotoxins that are toxic for humans and animals, and render grains unusable. Low efficiency in managing Fgr poses a constant need for identifying novel control mechanisms. Evidence that fungal extracellular vesicles (EVs) from pathogenic yeast have a role in human disease led us to question whether this is also true for fungal plant pathogens. We separated EVs from Fgr and performed a proteomic analysis to determine if EVs carry proteins with potential roles in pathogenesis. We revealed that protein effectors, which are crucial for fungal virulence, were detected in EV preparations and some of them did not contain predicted secretion signals. Furthermore, a transcriptomic analysis of corn (Zea mays) plants infected by Fgr revealed that the genes of some of the effectors were highly expressed in vivo, suggesting that the Fgr EVs are a mechanism for the unconventional secretion of effectors and virulence factors. Our results expand the knowledge on fungal EVs in plant pathogenesis and cross-kingdom communication, and may contribute to the discovery of new antifungals. The following are available online at www.mdpi.com/xxx/s1, Figure S1. Controls for the separation of EVs from Fusarium graminearum (Fgr) by SEC. Figure S2. The superoxide dismutase [Cu-Zn] (SOD1) from F. graminearum (Fgr) contains a diacidic amino acid motif implicated in unconventional secretion. Figure S3. Sequence alignment of the chitinase GH18 domain.  Figure S4. Computational prediction of effector candidates detected in EV samples from Fusarium graminearum (Fgr). Table S1. List of proteins detected in EVs from Fusarium graminearum (Fgr). Table S2. List of proteins employed in the computational effector prediction analysis. Table S3. Proteins identified in the secretome from Fusarium graminearum (Fgr). Table S4. List of transcripts identified in corn (Zea mays) infected by Fusarium graminearum (Fgr). Table S5. Gene expression values per biological replicate.

opencc-by-4.0Dec 2020View details →

dryad40/100

Novel fusarium wilt resistance genes uncovered in natural and cultivated strawberry populations are found on three non-homoeologous chromosomes

Open the record for dataset details and reuse information.

publicApr 2022View details →

zenodo36/100

Fusarium Genomes and their Host Ranges

This Appendix dataset accompanies a review of Fusarium genomes and their respective host ranges, entitled 'Navigating the Fusarium species complex: Host-Range Plasticity and Genome Variations', published in Fungal Biology (https://doi.org/10.1016/j.funbio.2024.07.004). The information within this dataset was correct as of March 2024 and includes information on Species, NCBI identifier, Assigned Phylogenetic Clade, The number of genomes available on NCBI, Ungapped Genome Size, Number of Chromosomes, Number of Core and Lineage Specific (LS) Chromosomes (by karyotyping), the Sequencing Methodology and Source. It also includes an extensive, but not universal, curation of known host ranges for each species. It is our hope that by making this dataset freely available it will encourage and inspire further research into the Fusarium genus.

opencc-by-4.0Jul 2024View details →

zenodo36/100

Fusarium Pan-Annotations: improved individual and collective genome annotations

A 'pan-annotation' of genomes from 77 taxa (83 accessions) across the genus Fusarium, delivered as part of the Earlham Institute Strategic Programme Grant 'Decoding Biodiversity' (BBSRC). Citation: <a href="https://www.doi.org/10.1101/2025.03.12.642647" target="_blank" rel="noopener">Leveraging existing data to maximise quality and consistency across gene model annotations: a Fusarium pan-annotation. bioRxiv doi:10.1101/2025.03.12.642647</a>

opencc-by-4.0Sep 2024View details →

zenodo36/100

SI_IV_3_Reverse chemical ecology to study the defense of the plant host Sextonia rubra and the chemical mediators of its endophyte Fusarium falciforme against phytopathogen Trametes versicolor

Ces travaux présentant les données supplémentaires générés lors de l'étude de la confrontation d'isolat identifiés comme des Fusarium falciforme contre Trametes versicolor.

opencc-by-4.0Sep 2023View details →

dryad36/100

Cold atmospheric plasma improves antifungal responsiveness of Aspergillus flavus and Fusarium keratoplasticum conidia and mycelia

Open the record for dataset details and reuse information.

publicJul 2025View details →

dryad36/100

Data from: Leveraging historical trials to predict Fusarium head blight resistance in spring wheat breeding programs

Open the record for dataset details and reuse information.

publicJan 2025View details →

dryad36/100

Data from: First report of Fusarium citri as an entomopathogenic fungus mediating plant resistance against insect pests and phytopathogens

Open the record for dataset details and reuse information.

publicOct 2024View details →

dryad36/100

Phenotype pictures of wheat heads infected with Fusarium graminearum

Open the record for dataset details and reuse information.

publicApr 2025View details →

zenodo32/100

Fig. 11 in New endemic Fusarium species hitch-hiking with pathogenic Fusarium strains causing Panama disease in small-holder banana plots in Indonesia

Fig. 11 Fusarium longipes (InaCC F974). a. Culture grown on PDA; b–c. sporodochia on carnation leaves; d. sporodochial conidiophores; e–f. branched conidiophores; g. falcate-shaped macroconidia; h. microconidia; i. chlamydospores. — Scale bars: b–k = 10 µm.

opennotspecifiedMar 2019View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas

neuroscienceopenDocumentation, web resources, and API references are available online.

Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage

behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.

Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb

electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.

Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl

behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.

Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro

neuroscienceopenPublished datasets are available on demand over the internet.

Last verified 2026-04-29Open record