Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

43

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

43 results for “Iso-Seq”

Learn how ShareScore rates datasets ↗
zenodo40/100

FMR1 Iso-Seq intermediate files: FLNC and nFL reads

<p>Over 40% of males and ~16% of female carriers of <em>FMR1</em> premutation allele (55-200 CGG repeats) are at risk for developing Fragile X-associated Tremor/Ataxia Syndrome (FXTAS), an adult onset neurodegenerative disorder. On the other hand, about 20% of female carriers will develop Fragile X-associated Primary Ovarian Insufficiency (FXPOI), in addition to a number of adult-onset clinical problems (<em>FMR1</em> associated disorders). Marked elevation in <em>FMR1</em> mRNA levels have been observed with premutation alleles resulting in RNA toxicity. This molecular mechanism has been proposed as the leading molecular mechanism to explain the phenotypes observed in premutation carriers.</p> <p>The <em>FMR1</em> gene, as many housekeeping genes, undergoes alternative splicing. Using Single Molecule, Real-Time (SMRT) sequencing and qRT-PCR we have recently reported that the relative abundance of all <em>FMR1</em> mRNA isoforms is significantly increased in the premutation group compared to controls. In this study, we have further investigated the transcriptional <em>FMR1</em> isoforms distribution pattern in different tissues including muscle, brain, heart and testes from 3 individuals with premutation allele and FXTAS and compared them to the isoform profiles of age-matched controls. Here we report on the identification of novel isoforms, some of which are observed only in premutation carriers and might play a role in the pathogenesis of FXTAS.</p> <p>Our findings suggest that the characterization of expression levels of the different <em>FMR1</em> isoforms is fundamental for understanding the regulation of the <em>FMR1</em> gene as well as for elucidating the mechanism(s) by which “toxic gain of function” of the <em>FMR1</em> mRNA may play a role in FXTAS and/or in the other <em>FMR1</em>-associated conditions. In addition to the elevated levels of <em>FMR1</em> isoforms, the altered abundance/ratio of the corresponding FMRP isomers may affect the overall function of FMRP in premutations.</p>

opencc-by-sa-4.0Nov 2016View details →
zenodo40/100

FMR1 Iso-Seq: per sample intermediate files

<p><em>FMR1</em> premutation carriers (55-200 CGG repeats) are at risk for developing Fragile X-associated Tremor/Ataxia Syndrome (FXTAS), an adult onset neurodegenerative disorder. In addition, 20 % of female carriers will develop Fragile X-associated Primary Ovarian Insufficiency (FXPOI), in addition to a number of clinical problems affecting premutation carriers throughout their life span. Marked elevation in <em>FMR1</em> mRNA levels have been observed with premutation alleles resulting in RNA toxicity, the leading molecular mechanism proposed for the <em>FMR1</em> associated disorders observed in premutation carriers.</p> <p>The <em>FMR1</em> gene, undergoes alternative splicing and we have recently reported that the relative abundance of all <em>FMR1</em> mRNA isoforms is significantly increased in premutation carriers.</p> <p>In this study, we further investigated the transcriptional <em>FMR1</em> isoforms distribution pattern in different tissues and identified a total of 49 isoforms, some of which observed only in premutation carriers and which might play a role in the pathogenesis of FXTAS.</p> <p>Further, we investigated the distribution pattern and expression levels of the <em>FMR1</em> isoforms in asymptomatic premutation carriers and in those with FXTAS and found no significant difference between the two groups.</p> <p>Our findings suggest that the characterization of the expression levels of the different <em>FMR1</em> isoforms is fundamental for understanding the regulation of the <em>FMR1</em> gene as imbalance in their expression could lead to an altered functional diversity with neurotoxic consequences. Their characterization will also help to elucidating the mechanism(s) by which “toxic gain of function” of the <em>FMR1</em> mRNA may play a role in FXTAS and/or in the other <em>FMR1</em>-associated conditions.</p>

opencc-by-4.0Jul 2017View details →
zenodo40/100

FMR1 Iso-Seq: final files

<p>seng, E., Tang, H.-T., AlOlaby, R. R., Hickey, L. &amp; Tassone, F. Altered expression of the FMR1 splicing variants landscape in premutation carriers. <em>BBA - Gene Regulatory Mechanisms</em> <strong>1860,</strong> 1117&ndash;1126 (2017).</p> <p><em>FMR1</em> premutation carriers (55-200 CGG repeats) are at risk for developing Fragile X-associated Tremor/Ataxia Syndrome (FXTAS), an adult onset neurodegenerative disorder. In addition, 20 % of female carriers will develop Fragile X-associated Primary Ovarian Insufficiency (FXPOI), in addition to a number of clinical problems affecting premutation carriers throughout their life span. Marked elevation in <em>FMR1</em> mRNA levels have been observed with premutation alleles resulting in RNA toxicity, the leading molecular mechanism proposed for the <em>FMR1</em> associated disorders observed in premutation carriers.</p> <p>The <em>FMR1</em> gene, undergoes alternative splicing and we have recently reported that the relative abundance of all <em>FMR1</em> mRNA isoforms is significantly increased in premutation carriers.</p> <p>In this study, we further investigated the transcriptional <em>FMR1</em> isoforms distribution pattern in different tissues and identified a total of 49 isoforms, some of which observed only in premutation carriers and which might play a role in the pathogenesis of FXTAS.</p> <p>Further, we investigated the distribution pattern and expression levels of the <em>FMR1</em> isoforms in asymptomatic premutation carriers and in those with FXTAS and found no significant difference between the two groups.</p> <p>Our findings suggest that the characterization of the expression levels of the different <em>FMR1</em> isoforms is fundamental for understanding the regulation of the <em>FMR1</em> gene as imbalance in their expression could lead to an altered functional diversity with neurotoxic consequences. Their characterization will also help to elucidating the mechanism(s) by which &ldquo;toxic gain of function&rdquo; of the <em>FMR1</em> mRNA may play a role in FXTAS and/or in the other <em>FMR1</em>-associated conditions.</p>

opencc-by-4.0Jul 2017View details →
zenodo40/100

F1 Maize Iso-Seq - Final & Intermediate files

<p>===============================================================================</p> <p>Variant Phasing and Haplotypic Expression from Single-molecule Sequencing in Maize</p> <p>===============================================================================</p> <p>Maize is a diploid species with very high genetic diversity.&nbsp;Haplotype phasing of genetic variants&nbsp;in maize is important for interpretation of the genome, population genetic&nbsp;and functional genomic analysis of allelic activity.&nbsp;However,&nbsp;due to splicing variability and sequencing length limitation,&nbsp;phasing at isoform level are always&nbsp;very challenge. Here, we&nbsp;developed a tool called&nbsp;&lsquo;Iso-Phase&rsquo;&nbsp;to phase the&nbsp;isoforms&nbsp;in hybrids and&nbsp;present the first isoforms phasing study in maize using inbred lines&nbsp;B73 and Ki11, as well as their reciprocal crosses&nbsp;from&nbsp;full-length single-molecule sequencing.&nbsp;Our results show that maize parental lines and hybrid lines display different splicing activity, and 6,847 genes can be phased&nbsp;through Iso-Phase&nbsp;in&nbsp;two reciprocal&nbsp;hybrids using embryo, endosperm and root tissues.&nbsp;We&nbsp;identified&nbsp;parental origin isoforms in maize hybrids,&nbsp;different novel isoforms between maize parent and hybrid lines, provides measures of haplotypic expression that increase power and accuracy in studies of allelic expression. It is the first study of phased&nbsp;full-length&nbsp;isoforms&nbsp;in maize,&nbsp;as well as in plants,&nbsp;which provides insights&nbsp;about&nbsp;maize and&nbsp;plant heterosis at allele-specific full-length transcriptional level.&nbsp;The approach used in this study also provide important information for many other phasing studies in different species.&nbsp;</p>

opencc-by-4.0Dec 2018View details →
zenodo36/100

Iso-Seq ToFU2 experimental RC0 dataset 1 cell

<p>1 Sequel cell of RC0 (Lexogen SIRV + ERCC UHRR) Iso-Seq data for testing ToFU2.</p> <p> </p>

opencc-by-4.0Aug 2017View details →
dryad32/100

Aminoacyl-tRNA synthetase gene alignments from multiple Sileneae species generated from full-length transcripts using Iso-Seq and raw microscopy image files

<p>Trimmed and untrimmed alignments for the final aminoacyl-tRNA synthetases in <em>Sileneae </em>species and <em>Arabidopsis thaliana. W</em>e investigated the evolution of subcellular localization of aaRS enzymes in five different species from the plant lineage <em>Sileneae</em> that has experienced extensive and rapid mitochondrial tRNA loss. By analyzing full-length mRNA transcripts with single-molecule sequencing technology (PacBio Iso-Seq) and searching genome sequences, we found instances of predicted retargeting of an ancestrally cytosolic aaRS to the mitochondrion as well as scenarios where enzyme localization does not appear to change despite functional tRNA replacement.</p> <p>Nikon .nd2 raw microscopy files for the transient expression and imaging of predicted transit peptides and colocalization assays in <em>N. benthamiana</em> epithelial cells. The amino acid sequence plus 10 upstream amino acids of the protein body were fused to GFP and co-transfected with an eqFP611-tagged transit peptide from a known mitochondrially localized protein (isovaleryl-CoA dehydrogenase).</p>

opencc-zeroFeb 2022View details →
zenodo32/100

Long-read transcriptome data (Iso-Seq) of the human and mouse brain

<p>Datasets from&nbsp;&quot;<strong>Full-length transcript sequencing of human and mouse cerebral cortex identifies widespread isoform diversity and alternative splicing</strong>&quot;, SK.Leung, A.Jeffries. et al. (2021)</p> <p>Deposited files are generated from running Cupcake,&nbsp;SQANTI2 (v7.4) and filter.&nbsp;<br> Note, only the files generated from SQANTI2 filtering are deposited.&nbsp;<br> To re-run SQANTI, use the files in cupcake_collapse folder as input.&nbsp;</p> <p>Please refer to code (https://github.com/SziKayLeung/Whole_Transcriptome_Paper) for more information.&nbsp;</p> <p>Datasets:&nbsp;<br> - AdultCTX: Adult human prefrontal cortex tissue (n = 4) merged dataset<br> - FetalCTX: Fetal human prefrontal cortex tissue (n = 3) merged dataset<br> - FetalHIP: Fetal human hippocampus tissue (n = 2, subset of FetalCTX) merged dataset<br> - FetalSTR: Fetal human striatum tissue (n = 2, subset of FetalCTX) merged dataset<br> - MouseCTX: Mouse entorhinal cortex tissue (n = 12) merged dataset</p>

opencc-by-4.0Nov 2021View details →
dryad32/100

Aminoacyl-tRNA synthetase gene alignments from multiple Sileneae species generated from full-length transcripts using Iso-Seq and raw microscopy image files

Open the record for dataset details and reuse information.

publicDec 2022View details →
zenodo28/100

SNCA targeted cDNA: PacBio Iso-Seq raw data

<p><strong>The landscape of <em>SNCA</em> transcripts across </strong><strong>synucleinopathies</strong><strong>: New insights from long reads sequencing analysis</strong></p> <p><strong>cDNA capture using IDT xGen</strong><strong>&reg; Lockdown</strong><strong>&reg; Probes and single-molecule Isoform-Sequencing (Iso-Seq)</strong></p> <p>100-150ng of total RNA per reaction was reverse transcribed using the Clontech SMARTer cDNA synthesis kit and 12 sample specific barcoded oligo dT (with PacBio 16mer barcode sequences, see Supplementary Methods).&nbsp; Three reverse transcription (RT) reactions were processed in parallel for each sample. PCR optimization was used to determine the optimal amplification cycle number for the downstream large-scale PCR reactions. A single primer (primer IIA from the Clontech SMARTer kit 5&rsquo; AAG CAG TGG TAT CAA CGC AGA GTA C 3&rsquo;) was used for all PCR reactions post-RT. Large scale PCR products were purified separately with 1X AMPure PB beads and the bioanalyzer was used for QC. An equimolar pool of 12-plex barcoded cDNA library (1&micro;g total) was input into the probe based capture with a custom designed SNCA gene panel.</p> <p>A SMRTBell library was constructed using 874ng of captured and re-amplified cDNA (https://www.pacb.com/wp-content/uploads/Procedure-Checklist-%E2%80%93-cDNA-Capture-Using-IDT-xGen-Lockdown-Probes.pdf).&nbsp; One SMRT Cell (6 hour movie) was sequenced on the PacBio Sequel platform using 2.0 chemistry.&nbsp;&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>The 5&rsquo; primer is identical for all patient samples: AAGCAGTGGTATCAACGCAGAGTACATGGG</p> <p>The 3&rsquo; primer for the 12 patient samples are below:</p> <p>PD-1: CGCACTCTGATATGTGGTACTCTGCGTTGATACCACTGCTT</p> <p>PD-2: CTCACAGTCTGTGTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>PD-3: CTCTCACGAGATGTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>PD-4: CGCGCGTGTGTGCGTGGTACTCTGCGTTGATACCACTGCT</p> <p>N-1: ACGCGAGAGTCGAGTGGTACTCTGCGTTGATACCACTGCTT</p> <p>N-2: ACAGCTGATATATATGGTACTCTGCGTTGATACCACTGCTT</p> <p>N-3: CACATAGAGATACAGAGTACTCTGCGTTGATACCACTGCTT</p> <p>N-4: CGCAGCGCTCGACTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-1: TCTGTCTCGCGTGTGTGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-2: CTCTGAGATAGCGCGTGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-3: ATAGATATACGTATAGGTACTCTGCGTTGATACCACTGCTT</p> <p>DLB-4: ACACGCGATCTAGTGTGTACTCTGCGTTGATACCACTGCTT</p>

opencc-by-4.0Nov 2018View details →
geo24/100

Harpegnathos saltator RNA-seq and Iso-Seq

GEO Series GSE172309. Harpegnathos saltator. 28 samples. Type: Expression profiling by high throughput sequencing; Other.

openGEO-OpenNov 2021View details →
geo24/100

ISO-seq analysis of MYB isoforms in T-ALL cell lines and patient-derived xenografts

GEO Series GSE267373. Homo sapiens. 4 samples. Type: Other.

openGEO-OpenNov 2024View details →
geo24/100

Aberrant splicing in Huntington’s disease accompanies disrupted TDP-43 activity and altered m6A RNA modifications [ISO-seq]

GEO Series GSE279460. Mus musculus. 16 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenJan 2025View details →
geo24/100

Trans-acting long non-coding RNA modulates long-range chromatin interactions associated with oncogenic MYC signaling [Iso-Seq]

GEO Series GSE208743. Homo sapiens. 2 samples. Type: Other.

openGEO-OpenJan 2026View details →
geo24/100

Iso-seq analysis of hepatocellular carcinoma (HCC), in which HBV-KMT2B integration was identified. The tumor region and nontumorous region were extracted from the HCC surgical specimen.

GEO Series GSE218329. Homo sapiens. 1 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenJan 2025View details →
geo24/100

Reference Long-read Isoform-aware Transcriptomes of Activated Human CD4 T cells (PacBio Iso-Seq, matched to Illumina RNA-Seq Data)

GEO Series GSE229971. Homo sapiens. 4 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenFeb 2025View details →
geo24/100

Reference Short-Read Transcriptomes of Activated Human CD4 T cells (Illumina RNA-Seq, Matched to PacBio Iso-Seq Data)

GEO Series GSE229969. Homo sapiens. 4 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenFeb 2025View details →
geo24/100

Insights into transcriptional characteristics and homoeolog expression bias of embryo and endosperm in developing grain through mRNA-Seq and Iso-Seq

GEO Series GSE118474. Triticum aestivum. 12 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenAug 2018View details →
geo24/100

Iso-Seq analysis of barley CI 16151 and fast-neutron-derived, immune-compromised mutants infected with the powdery mildew fungus (Blumeria graminis f. sp. hordei; isolate 5874)

GEO Series GSE165730. Hordeum vulgare; Blumeria hordei. 6 samples. Type: Expression profiling by high throughput sequencing; Other.

openGEO-OpenMar 2021View details →
geo24/100

Reference Short-Read Transcriptomes of Human Peripheral Blood Lymphocytes (Illumina RNA-Seq, Matched to PacBio Iso-Seq Data)

GEO Series GSE202328. Homo sapiens. 4 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenSep 2022View details →
geo24/100

Human Brain Small Extracellular Vesicles Contain Selectively-Packaged, Full-Length mRNA [bulk Iso-Seq]

GEO Series GSE255462. Mus musculus. 18 samples. Type: Other.

openGEO-OpenMar 2024View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record