Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

datasets available to search

ShareScore release 0.9.0

Dataset results

13 results for “Pistacia vera”

Learn how ShareScore rates datasets ↗

zenodo32/100

Fig. 4 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

Fig. 4. Somatic embryos induction of P. vera L. Sarakhs variety from immature zygotic embryos under dark condition after 60 days. Somatic embryos exhibited by arrows (a) Somatic embryos in globular stage, (b) Somatic embryos in heart stage, (c) Cotyledonary somatic embryos. Bar 2 mm.

opennotspecifiedMar 2019View details →

zenodo32/100

Fig. 6 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

Fig. 6. Secondary somatic embryos produced from primay somatic embryos of P. vera L. Sarakhs variety. Bar 2 mm.

opennotspecifiedMar 2019View details →

zenodo32/100

Fig. 8 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

Fig. 8. Relative expression of selected embryogenesis-related genes on embryonic and non-embryonic samples of two genotypes (a: Sarakhs variety and b: Ghazvini cultivar) of P.vera L in three technical replication.ACT was used as a reference gene for data normalization.Mean value and standard deviation (SD) were presented for three biological replicates.The significance differences (p <.01) and non-significant differences showed with two stars and "ns", respectively.

opennotspecifiedMar 2019View details →

zenodo28/100

PISTACIA VERA L. NING ERONDAN KELTIRILGAN NAVI KO`CHATLARINI YETISHTIRISH VA PISTA PLANTATSIYALARINI BARPO ETISHNING SAMARALI USULLARI

Open the record for dataset details and reuse information.

opencc-by-4.0Jun 2024View details →

zenodo28/100

Table 3 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

<p><b>Table 3</b> Effect of different plant growth regulators on induction of somatic embryos in three pistachio genotypes' explants (immature zygotic embryos) under light condition.</p><table><tbody><tr><th></th><th>Induction of somatic embryos %</th><th></th><th>Number of embryos/explant</th><th></th></tr></tbody><tbody><tr><th></th><td>Ghazvini</td><td>Badami Riz</td><td>Sarakhs</td><td>Ghazvini</td><td>Badami Riz</td><td>Sarakhs</td></tr><tr><th>E1</th><td>23.22 ± 3.39 c</td><td>22.74 ± 1.46d</td><td>24.67 ± 1.45 c</td><td>4.3 ± 1.2b</td><td>12.33 ± 1.45b</td><td>8 ± 0.58b</td></tr><tr><th>E2</th><td>34.25 ± 0.92b</td><td>34.66 ± 0.22 c</td><td>35.31 ± 0.85b</td><td>12.33 ± 1.45a</td><td>45 ± 2.88 a</td><td>11.33 ± 1.45a</td></tr><tr><th>E6</th><td>43.75 ± 3.6ab</td><td>43.58 ± 0.87b</td><td>42.83 ± 2.80a</td><td>5.33 ± 0.88b</td><td>10 ± 1.15b</td><td>7.67 ± 0.88b</td></tr><tr><th>E11</th><td>50.00 ± 4.12a</td><td>49.95 ± 1.19a</td><td>48.67 ± 2.03a</td><td>4.67 ± 0.88b</td><td>9.33 ± 1.20b</td><td>6 ± 0.58b</td></tr></tbody></table><p>Data within a column followed by different letters indicate significantly differences according to the LSD test at p <.05.</p>

opennotspecifiedMar 2019View details →

zenodo28/100

Table 2 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

<p><b>Table 2</b> PCR primer sequences of selected somatic embryogenesis-related genes for qRT in pistachio.</p><table><tbody><tr><th>Gene name</th><th>Forward primer sequence 5′-3′</th><th>Reverse primer sequence 5′-3′</th><th>Tm (̊C)</th><th>Amplicon length (bp)</th></tr></tbody><tbody><tr><th><i>ACT</i></th><td>GTATCCACGAGACCACCTACA</td><td>GGAGCAACGACCTTGATCTTC</td><td>60</td><td>157</td></tr><tr><th><i>AGL15</i></th><td>GGAGCAATCAAGAGTACAGGAACAG</td><td>CACTTCAGGACTTGCAGAACTATGG</td><td>60</td><td>187</td></tr><tr><th><i>LEC</i></th><td>GATGTGGGGTCTCTTGGAAGGA</td><td>AGCCTGTTTTGCTTTACGAAATCTC</td><td>60</td><td>209</td></tr><tr><th><i>BBM</i></th><td>TCCCAATTAGCAACTACGAGAAAGAG</td><td>CTGATGATGCCTTGTAACACCAC</td><td>60</td><td>140</td></tr><tr><th><i>PKL</i></th><td>GTAGACATCGCACCCTCTTAACTG</td><td>GAGCCAGCATTTTATGAAGTCTTGA</td><td>60</td><td>174</td></tr></tbody></table>

opennotspecifiedMar 2019View details →

zenodo28/100

Table 1 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

<p><b>Table 1</b> Summary of different responses of zygotic immature embryos to different basal medium (BM1 and BM2), combination and concentration of plant growth regulators (PGRs), and light and dark conditions.The response of explants was in the form of callus (C), somatic embryogenesis (SE), and adventitious shoot (AS).The Basal media were BM1: MS mineral salts,B5 vitamins, 30 g L <i>−</i> 1 sucrose, BM2: half strength MS macro salts, B5 vitamins, 100 mg L <i>−</i> 1 L-glutamine, 500 mg L <i>−</i> 1 casein hydrolysate, and 30 g L <i>−</i> 1 sucrose.</p><table><tbody><tr><th>Coding</th><th>PGRs combinations (mg L <i>−</i> 1)</th><th>Light</th><th>Dark</th></tr></tbody><tbody><tr><th></th><td></td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td><td>BM1</td><td>BM2</td></tr><tr><th></th><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td><td>C</td><td></td><td>SE</td><td></td><td>AS</td><td></td></tr><tr><th>E1</th><td>0</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E2</th><td>0.01 IBA</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E3</th><td>0.01 IBA + 1 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E4</th><td>0.01 IBA + 2 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td></tr><tr><th>E5</th><td>0.01 IBA + 3 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E6</th><td>0.01 2,4-D</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E7</th><td>0.01 2,4-D + 0.1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E8</th><td>0.01 2,4-D + 0.25 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E9</th><td>0.01 2,4-D + 0.5 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E10</th><td>0.01 2,4-D + 1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E11</th><td>0.01 NAA</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E12</th><td>0.01 NAA + 1 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td></tr><tr><th>E13</th><td>0.01 NAA + 2 BA</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>+</td></tr><tr><th>E14</th><td>0.01 IBA + 0.1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E15</th><td>0.01 IBA + 0.25 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E16</th><td>0.01 IBA + 0.5 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td><td>–</td><td>–</td></tr><tr><th>E17</th><td>0.01 IBA + 1 TDZ</td><td>–</td><td>–</td><td>–</td><td>–</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>+</td><td>–</td><td>–</td></tr></tbody></table><p>«–» and « + » represent nonexistence and existence the response on explants that cultured in intended media, respectively.</p>

opennotspecifiedMar 2019View details →

geo20/100

Cell layer-specific modification of cell wall is associated with exo-mesocarp split in pistachio (Pistacia vera L.)

GEO Series GSE300184. Pistacia vera. 20 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenJun 2025View details →

zenodo20/100

Fig. 5 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

Fig. 5. Longitudinal sections different developmental stages of somatic embryos in P. vera L. Sarakhs variety obtained from immature zygotic embryos under light condition: (a) Heart-shaped somatic embryos arising from epidermal cells (arrow), (b) Somatic embryos in torpedo stage (c, d) Early cotyledonary stage somatic embryo with shoot apical meristem (SAM) and no connection to vascular system (VS).

opennotspecifiedMar 2019View details →

zenodo20/100

Fig. 1 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

Fig. 1. Somatic embryos induced from immature zygotic embryos of P. vera L. Sarakhs variety after 30 days incubation in initiatioan medium and light condition. (a) Somatic embryos in globular stage, (b) Somatic embryos in heart stage, (c) Asynchronous somatic embryos, (d) Somatic embryo in torpedo stage (e) Cotyledonary somatic embryos with distinct root and shoot poles, and (f) Germinated somatic embryos (g) Acclimatized plants after transplanting for 8 weeks. Bar 2 mm.

opennotspecifiedMar 2019View details →

zenodo20/100

Fig. 2 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

Fig. 2. The effect of type and concentrations of plant growth regulators on percentage (a) and number of (b) somatic embryos developed from immature zygotic embryos of three genotypes of P. vera after 30 days under light condition. Data represented mean ± SE of three repeated experiments.

opennotspecifiedMar 2019View details →

zenodo20/100

Fig. 3 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

Fig. 3. Interaction of plant growth regoulators treatments and genotypes on adventitious shoots' percentage obtained from immature zygotic embryos of three genotypes of P.vera under light condition. Data represented mean ± SE of three repeated experiments. Treatments are included: (E1): control, without hormone, (E2): 0.01 mg L −1 IBA + 1 mg L −1 BA, (E3): 0.01 mg L −1 IBA + 2 mg L − 1 BA, (E4): 0.01 mg L −1 IBA + 3 mg L −1 BA, (E5): 0.01 mg L −1 IBA + 3 mg L −1 BA, (E12): 0.1 mg L −1 NAA + 1 mg L −1 BA, (E13): 0.01 mg L −1 NAA + 1 mg L −1 BA, (E14): 0.02 mg L −1 IBA + 0.1 mg L −1 TDZ, (E15): 0.02 mg L −1 IBA+ 0.25 mg L −1 TDZ, (E16): 0.02 mg L −1 IBA + 0.5 mg L −1 TDZ,(E17): 0.02 mg L −1 IBA + 1 mg L −1 TDZ.

opennotspecifiedMar 2019View details →

zenodo16/100

Fig. 7 in Direct somatic embryogenesis of drought resistance pistachio (Pistacia vera L.) and expression analysis of somatic embryogenesis-related genes

Fig. 7. Flow chart of somatic embryogenesis system for pistachio. Bar 2 mm.

opennotspecifiedMar 2019View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas

neuroscienceopenDocumentation, web resources, and API references are available online.

Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage

behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.

Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb

electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.

Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl

behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.

Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro

neuroscienceopenPublished datasets are available on demand over the internet.

Last verified 2026-04-29Open record