Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
13
datasets available to search
ShareScore release 0.9.0
Dataset results
13 results for “Quercus suber”
Genome-scale metabolic model of Quercus suber
<p>Genome-scale metabolic model of Quercus suber in SBML Level 3 Version 2 format. This model was reconstructed using <em>merlin</em> (https://merlin-sysbio.org), an open-source software.</p>
Potential and realized distribution at 30m for Cork oak (Quercus suber) in Europe for 2000 - 2020
<p>Probability and uncertainty maps showing the potential and realized distribution for the cork oak (<em>Quercus suber, L.</em>) for Europe from the dataset prepared by <a href="http://doi.org/10.5281/zenodo.5818021">Bonannella et al. (2022)</a> and predicted using Ensemble Machine Learning (EML). Potential distribution map cover the period 2018 - 2020; realized distribution cover the period 2000 - 2020, split in the following time periods:</p> <ul> <li>2000 - 2002,</li> <li>2002 - 2006,</li> <li>2006 - 2010,</li> <li>2010 - 2014,</li> <li>2014 - 2018,</li> <li>2018 - 2020.</li> </ul> <p>Files are named according to the following naming convention, e.g:</p> <ul> <li>veg_quercus.suber_anv.eml_md_30m_0..0cm_2000..2002_eumap_epsg3035_v0.3</li> </ul> <p>with the following fields:</p> <ul> <li>theme: e.g. <strong>veg</strong>,</li> <li>species code: e.g. <strong>quercus.suber</strong>,</li> <li>species distribution type: e.g. <strong>anv</strong> (= actual natural vegetation),</li> <li>species estimation method: e.g. <strong>eml</strong>,</li> <li>species estimation type: e.g. <strong>md</strong> ( = model deviation),</li> <li>resolution in meters e.g. <strong>30m</strong>,</li> <li>reference depths (vertical dimension): e.g. <strong>0..0cm</strong>,</li> <li>reference period begin end: e.g. <strong>2000..2002</strong>,</li> <li>reference area: e.g. <strong>eumap</strong>,</li> <li>coordinate system: e.g. <strong>epsg3035</strong>,</li> <li>data set version: e.g. <strong>v0.3</strong>.</li> </ul> <p>For each species is then easy to identify probability and uncertainty distribution maps:</p> <ul> <li>veg_quercus.suber_<strong>anv</strong>.eml_<strong>md</strong>: model uncertainty for realized distribution</li> <li>veg_quercus.suber_<strong>anv</strong>.eml_<strong>p</strong>: probability for realized distribution</li> <li>veg_quercus.suber_<strong>pnv</strong>.eml_<strong>md</strong>: model uncertainty for potential distribution</li> <li>veg_quercus.suber_<strong>pnv</strong>.eml_<strong>p</strong>: probability for potential distribution</li> </ul> <p>Files are provided as <a href="https://gdal.org/drivers/raster/cog.html">Cloud Optimized GeoTIFFs</a> and projected in the Coordinate Reference System ETRS89 / LAEA Europe (= EPSG code 3035). Styling files are provided in both <em>SLD</em> and <em>QML</em> format.</p> <p>If you would like to know more about the creation of the maps and the modeling:</p> <ul> <li><strong>watch</strong> the talk at Open Data Science Workshop 2021 (<a href="https://doi.org/10.5446/55256">TIB AV-PORTAL</a>)</li> <li><strong>access </strong>the repository with our R/Python scripts and follow the instructions (<a href="https://gitlab.com/geoharmonizer_inea/spatial-layers/-/tree/master/veg_mapping">GitLab</a>)</li> <li><strong>access </strong>the repository with the training dataset (<a href="https://doi.org/10.5281/zenodo.5818021">Zenodo</a>)</li> <li><strong>read </strong>the tutorial with executable code on our <a href="https://opengeohub.github.io/spatial-prediction-eml/spatiotemporal-ml.html#spatiotemporal-distribution-of-fagus-sylvatica">GitBook</a></li> </ul> <p>A publication describing, in detail, all processing steps, accuracy assessment and general analysis of species distribution maps is available on <a href="https://doi.org/10.7717/peerj.13728">PeerJ</a>. To suggest any improvement/fix use <a href="https://gitlab.com/geoharmonizer_inea/spatial-layers/-/issues">https://gitlab.com/geoharmonizer_inea/spatial-layers/-/issues</a></p>
SQLite3 databases of candidate marker loci from ddRADseq in Quercus suber, Quercus ilex and their hybrids
<p>The dataset contatins four SQLite3 databases of candidate marker loci from ddRADseq in <em>Quercus suber</em>, <em>Quercus ilex </em>and their hybrids, corresponding to the data collected for the four filtering/imputation scenarios considered in the manuscript "ddRAD sequencing-based identification of species genomic boundaries and permeability in <em>Quercus ilex</em> and <em>Q. suber</em> hybrids" submitted to Frontiers in Plant Sciences. This work was funded by the project AGL2015-67495-C2-2-R (Spanish Ministry of Economy and Competitiveness).</p>
Germination of range-wide Quercus suber L. populations
<p>This database contains the individual germination times and rates of cork oak acorns under controlled conditions. Acorns were collected in 2021 from 9 natural populations comprising 10 mother trees per population in France, Italy, Portugal and Spain. The acorns were weighed per mother tree before being sown under controlled conditions at 15, 20 and 25°C. The final size of this database is 718 individual entries which include seed mass, germination rates and timing, and the emergence of the first leaf. The populations from which the acorns were collected are geo-referenced and the mother trees are identified by their circumference and dbh.</p>
FIGURE. In the foreground, Aljíbico sector with Pinus pinaster and Quercus suber, in the centre Bermejense sector with serpentine scrublands and in the background the Rondeño sector with the highest summit of the studied area (La Torrecilla, 1,918 m) oromediterranean bioclimatic belt. (Photo authors) in Vascular flora of the Sierra de las Nieves National Park and its surroundings (Andalusia, Spain)
FIGURE. In the foreground, Aljíbico sector with Pinus pinaster and Quercus suber, in the centre Bermejense sector with serpentine scrublands and in the background the Rondeño sector with the highest summit of the studied area (La Torrecilla, 1,918 m) oromediterranean bioclimatic belt. (Photo authors)
FIGURES 34–37. 34, D in Description of Dryocosmus destefanii new species (Hymenoptera: Cynipidae: Cynipini) from Quercus suber L. in Italy
FIGURES 34–37. 34, D. jungalii, female, head, anterior view; 35, D. kuriphilus, mesoscutellum, dorsal view; 36–37, Mesoscutellum, dorsal view: 36, D. mayri, 37, D. cerriphilus, sexual female.
FIGURES 18–27 in Description of Dryocosmus destefanii new species (Hymenoptera: Cynipidae: Cynipini) from Quercus suber L. in Italy
FIGURES 18–27. Dryocosmus destefanii new species, asexual female: 18, metascutellum and propodeum, posterodorsal view, 19, Magnification of the metascutellum and propodeum (postero-ventral view); 20, pronotum and propleuron, frontal view; 21, forewing; 22, metasoma (lateral view); 23, ventral spine of hypopygium, ventral view; 24, ventral spine of hypopygium, lateral view; 25, fore tarsus and protibial spur; 26, mid tarsus and mid tibial spur; 27, hind tarsus and hind tibial spur.
FIGURES 28–33. 28–29 in Description of Dryocosmus destefanii new species (Hymenoptera: Cynipidae: Cynipini) from Quercus suber L. in Italy
FIGURES 28–33. 28–29, Chilaspis nitida, asexual female: 28, antenna, 29, head, front view; 30–31, Dryocosmus caspiensis, asexual female: 30, antenna, 31, mesosoma, dorsal view; 32, D. tavakolii, mesoscutellum, dorsal view; 33, D. cerriphilus, asexual female, head, anterior view.
FIGURES 10–17 in Description of Dryocosmus destefanii new species (Hymenoptera: Cynipidae: Cynipini) from Quercus suber L. in Italy
FIGURES 10–17. Dryocosmus destefanii new species, asexual female: 10, head (front view); 11, head (posterior view); 12, head (dorsal view); 13, head (lateral view); 14, Magnification of the lower face and malar space; 15, antenna; 16, mesoscutum and mesoscutellum (dorsal view); 17, mesosoma (lateral view).
FIGURES 1–9. 1–4 in Description of Dryocosmus destefanii new species (Hymenoptera: Cynipidae: Cynipini) from Quercus suber L. in Italy
FIGURES 1–9. 1–4, Dryocosmus destefanii new species, galls: 1–3, general appearance; 4, dissected gall, showing thin gall wall; 5–7, Chilaspis nitida, galls: 5–6, general appearance; 7, dissected gall, showing the small larval chamber and the thick gall wall; 8, Dryocosmus caspiensis, galls, arrows show the peduncle; 9, Dryocosmus destefanii new species, habitus, asexual female (lateral view).
Data for: Detection and diversity of Phytophthora species from declining Quercus suber stands using both DNA metabarcoding and soil baiting techniques
<p>This dataset on Zenodo accompanies the manuscript Salvatore <em>et al.</em> (2024), Detection and diversity of <em>Phytophthora</em> species from declining <em>Quercus suber</em> stands using both DNA metabarcoding and soil baiting techniques.</p> <p>There are two files here on Zenodo:</p> <ul> <li><code>metadata.tsv</code> - plain text table as tab-separated variables</li> <li><code>raw_data.tar.gz</code> - compressed archive of 56 paired raw FASTQ files</li> </ul> <p>This represents a subset of one complete Illumina Nano MiSeq plate run at the James Hutton Institute also containing a small number of unrelated samples using the same protocol.</p> <p>To repeat the analysis described in the paper, first install THAPBI PICT. See <a href="https://github.com/peterjc/thapbi-pict/">https://github.com/peterjc/thapbi-pict/ </a>for instructions. At the time of the paper, v1.0.16 was the current release.</p> <p>Next, decompress the raw data into a folder of paired gzipped FASTQ files. There is no need to decompress those:</p> <pre><code> $ tar -zxvf raw_data.tar.gz</code><br><code> $ ls -1 raw_data/</code></pre> <p>If you wish, verify the checksums to confirm the data integrity:</p> <pre><code> $ cd raw_data/ $ md5sum -c MD5SUM.txt</code><br><code> $ cd ..</code></pre> <p>Setup output directories:</p> <pre><code> $ mkdir -p intermediate/ summary/</code></pre> <p>Run the THAPBI PICT pipeline:</p> <pre><code> $ thapbi_pict pipeline -m 1s3g -f 0 -a 15 -i raw_data/ \</code><br><code> -s intermediate/ -o summary/sardinia \</code><br><code> -t metadata.tsv -u -x 8 -c 4,5,3,2,7,6</code></pre> <p>The options here are as follows:</p> <ul> <li><code>-m</code> - use the 1s3g classifier (see methods)</li> <li><code>-f</code> - set to zero to disable the fractional abundance threshold</li> <li><code>-a</code> - set a lower absolute abundance threshold</li> <li><code>-i</code> - location of the input raw data</li> <li><code>-s</code> - optional location to store intermediate files</li> <li><code>-o</code> - output stem for reports</li> <li><code>-t</code> - filename for tab-separated-variable metadata</li> <li><code>-u</code> - show unsequenced samples defined in the metadata</li> <li><code>-x</code> - which metadata column contains Illumina FASTQ filename stems</li> <li><code>-c</code> - which metadata columns to include in the report.</li> </ul> <p>This leaves the <code>-d</code> option with the default provided ITS1 database. We are NOT taking advantage of the negative controls to automatically set a blanket minimum abundance as Control-Plate-3-Mix-3-Dry-P3-c_S56_L001 sadly has over 3000 <em>Phytophthora</em> reads.</p> <p>That takes under a minute to run, and classifies most of the samples.</p> <p>Opening the output file <code>summary/sardinia_20240912_v1.0.16.ITS1.samples.1s3g.xlsx</code> in Excel or similar should show you a table resembling Table 3 in the paper, without the baiting results, but with one row per sequencing sample, and additional columns with per-sample per-species read counts etc. The similarly named reads file as one row per unique amplicon sequence variant (ASV), and columns for each sequencing sample.</p> <p>All the <em>Phytophthora</em> classifications were to species level except a single ASV from E5BTB-DILUTE-Wet-P6_S17_L001 (S3 Bultei) with 15 reads, a perfect match to partial sequences MH588088.1 and MH593844.1, isolates Y1 and Y2, which is in the THAPBI PICT database but only at genus level:</p> <pre><code>>bad82a53fff502146e7ea00cbf2d9d3e Phytophthora<br>TTTCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCTAAAACTTTCCACGTGAACCGTTTCAAACCAAATAGTTGGGGGTCTTGTCTGGTGGCGGCTGCTGGCTTTATTGTTGGCGGCTGCTGCTGGGTGAGCCCTATCATGGCGAGCGTTTGGGCTTCGGCCTGAGCTAGTAGCATTTCTTTTAAACCCATTCCTTAATACTGATTATACT</code></pre> <p>There are 9 samples left simply as "Unknown" (all six from S2 Buddusò, one each from S3 Bultei, S4 Nuoro, and S6 Tempio). A further two samples contained low levels of an unknown sequence in addition to knowns.</p> <p>The unknown ASV from S1BTC-DILUTE-Wet-P6_S9_L001 (S3 Bultei) looks to be a novel <em>Phytophthora</em> if real, similar to <em>P. quercina</em>:</p> <pre><code>>3cd110db0a0b8fa8b971ea6b61c53970 Phytophthora?<br>TTTCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCTAAAAAACTTTCCACGTGAACCGTTTCAACCAATATTTTGGGGGTCTCGTCTGGCGTGCGGCTGTTGCTGTAAAAGGCGGCGGCTGTTGCTGGGTGAGCCCTATCATGGCAAACGTTTGGGCTTCGGTCTGAACAAGTAGCTCTTTTTTAAACCATTACTTATTACTGATTATACT</code></pre> <p>The unknown ASV from S4OC-DILUTE-Wet-P6_S2_L001 (S4 Nuoro) looks to be a <em>Pythium</em> (a perfect match to partial sequences MN269744 and KY822489 from uncultured clones):</p> <pre><code>>eac8c1931b4f8c57803e6ad9ffb4eb56 Pythium?<br>TTTCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCAAAAAACTATCCACGTGAACCGTTAAGCAAAAGTCTAGTTGGCTTGTGTTGTTCGGGAGTGTGTTGGGAAGAGCTTGGAGATGTCTTCGGATATTTCGATGCCTAGTACTGGACATCCTGGCGAGCGAGTCGGCTAGCAACGAAGGTCGGGAGTTCGCTTGCGGACTGATGTGCGCTTGTCGCATGTCGGTCGAAAGGCTTGAGCAAACGGCTGATCTATTACTTTTAAACCATACCATAACTACTGATGATACT</code></pre> <p>The unknown ASV from S9OC-Wet-P5_S12_L001 (S4 Nuoro) at only 38 reads seems to be an artefact of some kind, possibly chimeric:</p> <pre><code>>74933d826f6077cd5f3dd036f894429d Artefact?<br>TAGCCGTAGGGGAACCTGCGGCTGGATCACCTCCTTTCTGGATTCGGAAGGCAGGGATCAGTGATCAGTTATCAGAACCGATTGCTGCTCCTCTTCCGAGCATCCACAACGCCAGCTCTGGCAGGAATTCTGATATCTGATATCTGGTTTCTGCGATCTGGCAACGGCGCCGCCGTCTGCGCATCCCTTCTGCCGCGTTATTCCAGAGGGCAGTGATCAGTCATCAGAACCGATGGCGGATCCGCCCCCGGCTTCACGGCGAGCGCCCGAGCCTG</code></pre> <p>The remaining unknown ASVs were likely <em>Plasmopara</em>.</p> <p> </p>
Data from: Site- and tree-related factors affecting colonization of cork oaks Quercus suber L. by ambrosia beetles in Tunisia
Open the record for dataset details and reuse information.
Data from: Quercus suber dieback alters soil respiration and nutrient availability in Mediterranean forests
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.