Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

167

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

167 results for “mRNA decay”

Learn how ShareScore rates datasets ↗
zenodo44/100

Additional Data: Poised PABP-RNA hubs implement signal-dependent mRNA decay in development

<p>This repository contains processed data resulting from iCLIP experiments that were analysed in the following paper:"<strong>Poised PABP-RNA hubs implement signal-dependent mRNA decay in development</strong>"<br>The paper is published at Nature Structural and Molecular BIology.</p> <h2><br>Archived data</h2> <p>Data archived in this repository include:</p> <ol> <li>Data derived from iCLIP experiments targeting LIN28A, PABPC1, and PABPC4, that were analysed in the manuscript (see iCLIP.zip). Raw data is available&nbsp;from ENA, with the accession code PRJEB60519. <ol> <li>Sample descriptions are given in iCLIP-SampleAnnotation.csv</li> <li>Crosslink files in BED6 format (individual replicates and merged replicates)</li> <li>Peak files generated with the Clippy peak caller in BED6 format</li> <li>K-mer enrichment around high-confidence crosslink sites in the 3'-UTRs, calculated by the PEKA software</li> </ol> </li> <li>Expression values (salmon quantfiles)&nbsp; for 3'-seq experiments, specified in "QuantseqExperimentsAnnotation.tsv", are available in "SalmonQuantfiles.zip".&nbsp;Raw data is available from ENA, with the accession code PRJEB60519.</li> <li>Source code of the nextflow pipeline, which was used on the iMaps webserver to analyse iCLIP data and produce the files archived here (see imaps-nf-0.30.zip).</li> <li>A list of naive genes, that were analysed in the manuscript (see NaiveGeneIds.csv).</li> </ol> <h2>Details on iCLIP data generation</h2> <p>iCLIP data for LIN28A-WT (in 2iL and FGF2 treated cells), LIN28A-S200A (in FGF2 treated cells) as well as for PABPC1 and PABPC4 (in LIN28A KO cells with and without LIN28A overexpression), were analysed on iMaps Goodwright server (<a href="https://imaps.goodwright.com/">https://imaps.goodwright.com/</a>). The LIN28A iCLIPs were analysed on 18th of July, 2022; the PABPC iCLIPs were analysed on 26th of December, 2022. The code and settings used in the pipeline (release v0.30) can be viewed at <a href="https://github.com/goodwright/imaps-nf">https://github.com/goodwright/imaps-nf </a>, and is also archived here - (imaps-nf-0.30.zip)<br>&nbsp;</p> <ul> <li>First, reads were demultiplexed using Ultraplex and barcodes were trimmed from the reads. The default Ultraplex settings were applied, as denoted below:</li> </ul> <blockquote> <p>adapter='AGATCGGAAGAGCGGTTCAG'<br>adapter2='AGATCGGAAGAGCGTCGTG'<br>barcodes='barcode.csv',<br>final_min_length=20<br>fiveprimemismatches=1<br>ignore_no_match=False<br>ignore_space_warning=False<br>inputfastq='MOD4878A1-merged.fastq.gz',<br>keep_barcode=False,<br>min_trim=3,<br>outputprefix='demux',<br>phredquality=30,<br>phredquality_5_prime=0,<br>sbatchcompression=False,<br>threads=10,<br>threeprimemismatches=0,<br>ultra=False</p> </blockquote> <p>&nbsp;</p> <ul> <li>TrimGalore was used to run FASTQC and quality trim the reads and remove reads with length less than 10 nt:</li> </ul> <blockquote> <p>trim_galore --fastqc --length 10 -q 20 --cores 8 --gzip file.fastq.gz</p> </blockquote> <p>&nbsp;</p> <ul> <li>Reads were then premapped to rRNA, tRNA sequences referred to as small RNA, smRNA, using mouse genome build (GRCm39 GENCODE M28 annotation) with Bowtie v1.3.0 (Langmead et al., 2009)</li> </ul> <blockquote> <p>bowtie --threads 12 --sam -x $INDEX -q --un file.unmapped.fastq -v 2 -m 100 --norc --best --strata file.fq.gz 2</p> </blockquote> <p>&nbsp;</p> <ul> <li>Reads that did not map with Bowtie were then aligned with STAR v2.7.9a (Dobin et al., 2013) to mouse genome build (GRCm39 GENCODE M28 annotation).</li> </ul> <blockquote> <p>STAR \<br>--genomeDir star \<br>--readFilesIn file.unmapped.fastq.gz \<br>--runThreadN 12 \<br>--outFileNamePrefix 1_R1. \<br>\<br>--sjdbGTFfile Homo_sapiens_filtered.gtf \<br>--outSAMattrRGline 'ID:1_R1' 'SM:1_R1' \<br>&nbsp;--readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --quantMode TranscriptomeSAM --outFilterMultimapNmax 1 --outFilterMultimapScoreRange 1 --outSAMattributes All --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterType BySJout --alignIntronMin 20 --alignIntronMax 1000000 --outFilterScoreMin 10 --alignEndsType Extend5pOfRead1 --twopassMode Basic</p> </blockquote> <p>&nbsp;</p> <ul> <li>PCR-duplicates were removed using UMI-tools (Smith, Heger and Sudbery, 2017)</li> </ul> <blockquote> <p>java -jar /UMICollapse/umicollapse.jar \<br>&nbsp;&nbsp;bam \<br>&nbsp;&nbsp;-i file.Aligned.sortedByCoord.out.bam \<br>&nbsp;&nbsp;-o file.dedup.bam \<br>&nbsp;&nbsp;--umi-sep rbc:</p> </blockquote> <p>&nbsp;</p> <ul> <li>The nucleotide preceding each sequencing read was assigned as the crosslink event.</li> </ul> <p>&nbsp;</p> <ul> <li>Peaks of crosslinking signal were identified with Clippy v1.4.1, using the default settings.</li> </ul> <p>&nbsp;</p> <ul> <li>Obtained peaks and crosslink sites were used to run PEKA v1.0.0 (Kuret et al., 2022), using the default settings.</li> </ul> <p>&nbsp;</p> <ul> <li>For Clippy and PEKA, the GENCODE primary assembly annotation M28 was filtered to retain only entries with transcript support level 1 or 2, in genes where such transcripts were available, and used to produce a segmentation file with the <em>get_segments</em> function from the iCount tool (Curk, 2019).</li> </ul> <p>&nbsp;</p> <ul> <li>All files generated during data processing are available from the iMaps Goodwright webserver for analysis of CLIP data (see <a href="https://imaps.goodwright.com/collections/882635250203/">https://imaps.goodwright.com/collections/882635250203/</a> and <a href="https://imaps.goodwright.com/collections/340215254997/">https://imaps.goodwright.com/collections/340215254997/</a> for LIN28A and PABPC1/4 iCLIPs, respectively).</li> </ul> <h2>Source data</h2> <p>Raw sequencing reads, from which the data enclosed here were derived, are accessible at ENA (PRJEB60519).<br>The raw sequencing reads and all data produced by the analysis pipeline is also available at the iMaps webserver (see <a href="https://imaps.goodwright.com/collections/882635250203/">https://imaps.goodwright.com/collections/882635250203/</a> and <a href="https://imaps.goodwright.com/collections/340215254997/">https://imaps.goodwright.com/collections/340215254997/</a> for LIN28A and PABPC1/4 iCLIPs, respectively); and on the updated Flow webserver (see <a href="https://app.flow.bio/projects/882635250203/">https://app.flow.bio/projects/882635250203/</a> and <a href="https://app.flow.bio/projects/340215254997/">https://app.flow.bio/projects/340215254997/ </a>for LIN28A and PABPC1/4 iCLIPs, respectively).</p> <h2>Downstream computational analysis of enclosed data</h2> <p>The code, used to analyse the data enclosed here and train the CNN to predict transcript stability in naive-to-primed transition based on 3'UTR nucleotide sequence, is available at GitHub (<a href="https://github.com/ulelab/LIN28A_RNPreassembly_bioinformatics">https://github.com/ulelab/LIN28A_RNPreassembly_bioinformatics</a>) and archived on Zenodo (<a href="../doi/10.5281/zenodo.10054297">https://zenodo.org/doi/10.5281/zenodo.10054297</a><strong>).</strong></p>

opencc-by-4.0Oct 2023View details →
zenodo40/100

UPF3A and UPF3B are redundant and modular activators of nonsense-mediated mRNA decay in human cells

<p>Source data for the publication: UPF3A and UPF3B are redundant and modular activators of nonsense-mediated mRNA decay in human cells.<br> Includes raw image data (e.g. agarose gels, western blots, northern blots), quantifications, qPCR raw Ct values and other supporting material.</p>

opencc-by-4.0Feb 2022View details →
zenodo36/100

YB1 dephosphorylation attenuates atherosclerosis by promoting CCL2 mRNA decay

<p>&nbsp;Y-box binding protein 1 (YB1) is an RNA binding protein (RBP) that has been reported to play important roles in inflammation and atherosclerotic plaque formation.&nbsp;To explore the molecular mechanism of phosphorylated YB1 (pYB1)&nbsp;in atherosclerosis <em>in vitro</em>, we constructed YB1 phosphorylation site (Ser-100) mutant stable smooth muscle cell line (3ds-V5) and performed RNA profile screening through RNA-seq.&nbsp; We found inflammatory pathways and&nbsp;CCL2 was&nbsp;significantly decreased in the 3dS-V5 YB1 mutant compared with the control group (YB1-V5).</p>

opencc-by-4.0Jul 2022View details →
dryad28/100

Data from: Nonsense-mediated decay of alternative pre-mRNA splicing variants is a major determinant of the Arabidopsis steady state transcriptome

Open the record for dataset details and reuse information.

publicOct 2014View details →
dryad28/100

Transcriptome Analysis Reveals Extensive Alternative Splicing-Coupled Nonsense-Mediated mRNA Decay in a Human Cell Line

Open the record for dataset details and reuse information.

publicSep 2015View details →
dryad28/100

Polysome fractionation analysis reveals features important for human nonsense-mediated mRNA decay

Open the record for dataset details and reuse information.

publicAug 2019View details →
geo24/100

Differential Gene Expression and mRNA decay in Wild-Type and Myeloid-specific TTP Knock-out macrophages using RNA-Seq

GEO Series GSE229922. Mus musculus. 64 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenOct 2023View details →
geo24/100

Oligodendrocyte differentiation alters tRNA modifications and codon-dependent mRNA decay [QuantM-seq II]

GEO Series GSE198271. Saccharomyces cerevisiae. 8 samples. Type: Non-coding RNA profiling by high throughput sequencing.

openGEO-OpenAug 2022View details →
geo24/100

Global analysis of Upf1 in mESCs reveals expanded scope of nonsense-mediated mRNA decay

GEO Series GSE41785. Mus musculus. 23 samples. Type: Expression profiling by high throughput sequencing; Other.

openGEO-OpenJun 2013View details →
geo24/100

m6A sites in the coding region trigger translation-dependent mRNA decay (SLAM-seq)

GEO Series GSE273217. Homo sapiens. 18 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenNov 2024View details →
geo24/100

Embryonic lumenogenesis is controlled by selective mRNA decay triggered by LIN28A relocation [Slam-Seq]

GEO Series GSE169554. Mus musculus. 90 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenMar 2024View details →
geo24/100

m6A is decoded by modified tRNAs to coordinate mRNA decay [SLAM-Seq]

GEO Series GSE247664. Homo sapiens. 18 samples. Type: Expression profiling by high throughput sequencing; Other.

openGEO-OpenMay 2025View details →
geo24/100

Knockdown of YBX1 impairs alternative splicing and maternal mRNA decay during pre-implantation development

GEO Series GSE182908. Capra hircus. 6 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenJan 2022View details →
geo24/100

Heritable variation of mRNA decay rates in yeast

GEO Series GSE60617. Saccharomyces cerevisiae. 18 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenSep 2014View details →
geo24/100

Whole genome analysis of mRNA decay in P. falciparum reveals a lengthening of mRNA half-life during the IDC

GEO Series GSE8099. Plasmodium falciparum; Saccharomyces cerevisiae. 104 samples. Type: Expression profiling by array.

openGEO-OpenJul 2007View details →
geo24/100

m6A is decoded by modified tRNAs to coordinate mRNA decay [Quant-seq]

GEO Series GSE291842. Homo sapiens. 18 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenMay 2025View details →
geo24/100

m6A is decoded by modified tRNAs to coordinate mRNA decay [miCLIP]

GEO Series GSE248112. Homo sapiens. 1 samples. Type: Other.

openGEO-OpenMay 2025View details →
geo24/100

A novel Smg6 mouse model reveals circadian clock regulation through the nonsense-mediated mRNA decay pathway

GEO Series GSE208769. Mus musculus. 52 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenNov 2022View details →
geo24/100

Oligodendrocyte differentiation alters tRNA modifications and codon-dependent mRNA decay [DecaySeq]

GEO Series GSE182809. Mus musculus. 26 samples. Type: Expression profiling by high throughput sequencing.

openGEO-OpenAug 2022View details →
geo24/100

Translation of zinc finger domains induces ribosome collision and Znf598-dependent mRNA decay in zebrafish [Ribo-seq]

GEO Series GSE236144. Danio rerio. 4 samples. Type: Other; Expression profiling by high throughput sequencing.

openGEO-OpenOct 2024View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record