Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
2
datasets available to search
ShareScore release 0.9.0
Dataset results
2 results for “naive-bayes classifier”
18S V9 metabarcoding reference databases and naive-bayes classifier
<p>18S metabarcoding databases and naive-bayes classifiers specific to the V9 region. Built from the <a href="https://pr2-database.org/">PR2 database</a> using Qiime2 (version 2023.2)<a href="https://github.com/BenKaehler/q2-clawback">.</a> Includes a naive-bayes classifier for use with Qiime2. Sequences were dereplicated with Rescript --p-mode 'uniq' , retaining identical sequence records that have differing taxonomies.</p><p>Primers used:</p><p>EMP 18S 1391f: GTACACACCGCCCGTC</p><p>EMP 18S EukBr: TGATCCTTCTGCAGGTTCACCTAC</p><p><strong>Stats</strong></p><p>19,470 unique sequences</p><p>39,170 total sequences</p><p>11,748 unique taxa </p><p>Note: there were 221,085 sequences in the original PR2 database. Many were filtered out due to the in-silico extraction with our V9 primers.</p><h3>File Descriptions</h3><p><strong>Files in bold are recommended for taxonomic classification.</strong></p><p>Create naive-bayes classifier for 18S PR2 database.md: Markdown with code used to generate databases |</p><p><strong>pr2_v5.0.0_SSU_18S-V9_uniq-classifier.qza</strong>: Unweighted naive-bayes classifier for 18S V9 (primers 1391f, EukBr), extracted from PR2 v5.0.1, dereplicated, generated by qiime2-2023.2 |</p><p><strong>pr2_version_5.0.0_SSU_18S-V9_uniq_seqs.qza</strong>: Sequences for 18S V9 (primers 1391f, EukBr), extracted from PR2 v5.0.1, dereplicated, generated by qiime2-2023.2 |</p><p><strong>pr2_version_5.0.0_SSU_18S-V9_uniq_tax.qza</strong>: Taxa for pr2_version_5.0.0_SSU_18S-V9_uniq_seqs.qza (dereplicated) |</p><p>pr2_version_5.0.0_SSU_18S-V9_seqs.qza: Sequences for 18S V9 (primers 1391f, EukBr), extracted from PR2 v5.0.1, NOT dereplicated, generated by qiime2-2023.2 |</p><p>pr2_version_5.0.0_SSU_18S-V9_tax.qza: Taxa for pr2_version_5.0.0_SSU_18S-V9_seqs.qza (NOT dereplicated) </p><p>pr2_version_5.0.0_SSU_mothur.fasta: SSU sequences downloaded from PR2 v 5.0.1 |</p><p>pr2_version_5.0.0_SSU_mothur.tax: SSU taxa downloaded from PR2 v5.0.1 |</p><p>pr2_version_5.0.0_taxonomy.xlsx: Detailed taxonomy downloaded from PR2 v5.0.1 |</p>
16S V4-V5 metabarcoding reference databases and weighted naive-bayes classifiers, dereplicated
<p>16S metabarcoding databases and naive-bayes classifiers specific to the V4-V5 region. Built from the <a href="https://www.arb-silva.de/documentation/release-138/">Silva 138.1 SSU Ref NR 99</a> database using Qiime2 (version 2023.2) and the <a href="https://github.com/BenKaehler/q2-clawback">q2-clawback plugin.</a> Includes weighted classifiers for two Earth Microbiome Project Ontology (EMPO) 3 habitat types: "sediment (saline)" and "water (saline)" , with data downloaded from <a href="https://qiita.ucsd.edu/">Qiita</a>. Sequences were dereplicated with Rescript --p-mode 'uniq' , retaining identical sequence records that have differing taxonomies.</p> <p>Primers used:</p> <p>EMP 16S 515f: GTGYCAGCMGCCGCGGTAA</p> <p>EMP 16S 926r: CCGYCAATTYMTTTRAGTTT</p> <p><strong>Stats</strong></p> <p>286,948 unique sequences</p> <p>309,567 total sequences</p> <p>46,254 unique taxa (Level 7)</p> <table> <caption>File description</caption> <thead> <tr> <th scope="col"> <table> <thead> <tr> <th>File</th> <th>Description</th> </tr> </thead> <tbody> <tr> <td>make new 16S silva V4-V5 database.md</td> <td>Markdown with code used to generate databases</td> </tr> <tr> <td>silva-138-99-seqs.qza</td> <td>Full length Silva 138.1 SSU 99 sequences</td> </tr> <tr> <td>silva-138-99-tax.qza</td> <td>Taxa for full length Silva 138.1 SSU 99 database</td> </tr> <tr> <td>silva-138_1-99-515f_926r-uniq-seqs.qza</td> <td>Sequences for 16S V4-V5 (primers 515f, 926r), extracted from Silva 138.1 SSU 99, generated by qiime2-2023.2 (forward compatible), dereplicated</td> </tr> <tr> <td>silva-138_1-99-515f_926r-uniq-taxa.qza</td> <td>Taxa for silva-138_1-99-515f_926r-seqs.qza database, dereplicated</td> </tr> <tr> <td>uniform-silva-138_1-99-515f_926r-uniq-classifier.qza</td> <td>Unweighted (uniform) naive-bayes classifier for 16S V4-V5 (primers 515f, 926r) extracted from Silva 138.1 SSU 99, generated by qiime2-2023.2 (forward compatible)</td> </tr> <tr> <td>silva-138_1-99-515f_926r-uniq-sediment-saline-classifier.qza</td> <td>Weighted naive-bayes classifier for 16S V4-V5 (primers 515f, 926r) extracted from Silva 138.1 SSU 99, weighted for sediment-saline, generated by qiime2-2023.2 (forward compatible)</td> </tr> <tr> <td>silva-138_1-99-515f_926r-q2_2023_2-uniq-sediment-saline-weights.qza</td> <td>Weights used to generate silva-138_1-99-515f_926r-q2_2023_2-sediment-saline-classifier.qza</td> </tr> <tr> <td>silva-138_1-99-515f_926r-uniq-water-saline-classifier.qza</td> <td>Weighted naive-bayes classifier for 16S V4-V5 (primers 515f, 926r) extracted from Silva 138.1 SSU 99, weighted for water-saline, generated by qiime2-2023.2 (forward compatible)</td> </tr> <tr> <td>silva-138_1-99-515f_926r-uniq-water-saline-weights.qza</td> <td>Weights used to generate silva-138_1-99-515f_926r-water-saline-classifier.qza</td> </tr> </tbody> </table> </th> <th scope="col"> </th> </tr> </thead> <tbody> </tbody> </table> <p> </p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.